Description :
From Genome Similarity Track
Location :
contig_11:94546- 95710
Transcript NameFunction/comments
g2558.t1SH3 domain-containing protein

Sequence
1164 bases(100 bases per row)
TTGCGTTCTAATGGATGTGTTGCATGTCTTGCACTTCTTGTTCCAGACCTGGTGGGAGTGAGCCACGAAGACCTGGCAGTTGCAGGCGCGGCAAGCTCCC
ATCATGCGGGACATCTCGGCCAGCACCTCCTTGCGCTCTTGGATGCCGCGCATGGCACGGTCTAGCGCTTCATAAAGCGGTCTTGCTGCCATGGGCTGAC
CTACGGATCCACTGAGCAACGCACTCGCCTCGAGGTCTTGCCCGTAGAATTTCCGGTTCAGGTCGTTGCGTGTAGCGATCACAGAGCCCTGAAGCGAGAT
TCCTGCGTACAGGCCCTTGCTGATCGAGTAGCTGTAGTTACCATTGAGGCCGGAGCTGCTGATCGCTGCTGCAGCCGCAGCAGATCGCCCATAGGGCCCA
AGTGCGATGTCCAGTCCCGCGCCCAAATTCACTTGAGGCGAGTGGAAAACCTGCACGGAAGCCGGGGAACCGAGAATGATCATGACCTCGACGATCTCTC
CGCCGATCTCAAAGCCGCCGCCGAGCCCCACAGTGCCAATAGCTGAGGGCGCAGACCACGAGCCGTCCGGTAGTCGGGACACGACGATACCCGTGCCCAC
CTTCCCGACAACGAGGAAGCCAGCCTTGACGATCGTCATGACCGCCAAGCCGTGTGCGTTCTCGAGCATCGAAATCGGGATGGCCCTGTCCCCGGACGTG
CCCGAGTCGTTCCGGAAGAAGTTGCCAATGATATCCGCTGCGTTCGTGCACTCCTTTTCCAACGAGGGCGAGAACGGCACATGCAGCCTCGACTTGGCCT
CGTGTGGCGCCGTCTCGGCGTTGGCCTTGGCGTATCGAGCCACCAGGTCCTCCTGCAGAGGACGCAACTGAGGCGCGCAGTGCAAACACGCTCGCTGAGG
GATGGACGGGTCGTAGCCCCTGGCGCCTTCGATCTGGTCTCCGTCCGGGATCAGCAGCAGCAGCGGCGAGCAGGTGCCACACACGAAGCGACCACAAGCA
CGACTGCATCAATAGACAGACCACACAACCGTTAATATCCACCGCAGTGTGGAAGCACTCCTCAGCAGCAGAACGTACCATTGATGACGACGTTTAGTGA
CGTCGAAGGCCAAGCCGCAGATATCGCAGTTGGGGTGGTCCGAGTATCGGCCCTTGAGGACACC