Description :
From Genome Similarity Track
Location :
Scaffold_66:94527- 95875
Transcript NameFunction/comments
Phyra_96163PREDICTED: protein HIRA homolog

Sequence
1348 bases(100 bases per row)
GGAAGGGGCCCATCATTTCAGCGCACAAGTCATCCAGTCGAGTCACGTCCTCATCGTGCGTCAGGAACCTGGCATACGCTTGAACCCTGTTGAAAGCACG
ATTGTCAGCAATCAGCAACGACGGAGCTAGCTGTGGTTCCCCAAACACATACCAATAGCGATATTCGGTCGAGCTTTTGAGCACGATCGATGCGGCGACC
TGGTGCTCTAGGTGCGATCGCGTCACGTTGCGCTGCATCAATGGGTCGGCCATCCCTGACAACATGGCGGAAGCGATTCCTCGCTGCGTTCGACCGTAGC
CAGATGCATTTTGGAGCCGTCGCAATGGTCCGATCTGTCGAGAACGACAAAAATTGAACGCATTAGACCTACCAACCGATGCCAAGCGGTGAAACACACA
CGTACAGGTATGCTTTTGACTGCCACTGCATCAGTCGGAAGAGTTGACGTGAAGTCCGAAAACACAAAACTGTCGTCCGCCACTCGCATCCTTTTCAAAA
ACAACAAATAAATTAGTCAGCGATCATCCGGTTTGTGTATGCATCATGGATCTGTACCATGAACACATCGCCGTATCAAATGTGTACGACAGCAGGCTAG
AGTTGCCCTTCGTTTCGGAGTTTGACTCAGCAAAAGTAATCAGTGGCATCCCCTTCGTTGTCACTTGACACCGAAGGAGAGTCAGCTTGCGACGATCCTC
TGGTGCGACCTACACAGCAACACAACGAATGCCACACACAAAACTCGTAAGCTCACACGTAACGTTATGATCACACGAGGAAAACGCACATTCGTAATCG
CCTCAACTGAGCTTGAAAGTATGAGCTTGCGTGCCTCTAAGTCCCATATTTTTAGGTCGCCAGTCACTAGGATCACCAGCAGATAGGGCGAGTCACTCAC
ACTGCACTCCATTACCGAGATGGCACTGCCCAATGCTTCAAACCACAAAATACAGGTCAGCTTTAAAATATGCGGATTCGTACAAAAGTCTGATACGCAC
CAATGCACGGGAAAAGCCGCCGCCCGCTGCTGTTAAGGATAAGTAGATCTCCATTGTGAACACCAATCGCCCAGTAGCTTGCATTTCCTACTGCGCACAC
CGCTCGACCAGGGATACGATCTATCCACTTGACTTCACTTCCCTCCGAGCATTGAAGCGTTGAATAAACTGGACCTAACTCTGTGAGTGCCATGGCGATA
AGAGTGTCAGCGATAATTCTACCCAAGAAACCAACCTTCCCGATCGTAACTTACCTATAATTTCTTCTGGCTGAGGATTTTTCAGGTTGTGAACGGTAGC
TTCTACCACGGTCTTAGAGGGCATCAAACCATTACTTGTTTTGCCATT