Description :
From Genome Similarity Track
Location :
scaffold_36:94516- 98359
Transcript NameFunction/comments
g1670.t1 hypothetical protein PHYSODRAFT_560159
g1671.t1 hypothetical protein PHYSODRAFT_498950
g1672.t1 conserved hypothetical protein

Sequence
3843 bases(100 bases per row)
TTTGAGGACAGCGTCGACCAACTCGGCATGTTTGTCCTTGGTGATCAACTCCATTTCTACCTGCTCGAACGCAGCGACGTAGTTGTACTTCACGTATCCC
AGCCTGCATGGATGTGTGAATTACGCGTCAGAATTTATAAAGTAGCACCACGGTAGTATTTCAATATTCATCGTGGGGGAGCCTCACTTTTCGAAGAGCT
TGATTGACGCGTCGTTCGTCTCGATGATCTTGCAGATAAATCGGGTGACCTTGAGCTCCGACGTAGCTGCAGAGGCACATAAATCAATGTATCAGTCCTT
CAGCTGTTAAAACCCAGCACTTCTGTCACTCATACCATAAGCCATCATGAGCTTCACTGCTTCCTCGGCAAAGCCCTTGCGGCGATACTTCTCCTCGGCA
ATCATGATCTCCATCTCGCACGCGAGCGGGTCATCATAGTCATTAAAGAACAAATTAACGTCCCCAGCCATGCCTACAGTATGCAAATAAGTCATTCCAG
GTCCAATTTAACTTCCAACAGTGCCTGCAACTTACGATCAACAGCACCCTCGTCGATGTACGATGTCCCAGGCTTCCCATCCTCGTCAGCCTTGGCTAGC
ACGATGAAGGTGCACTCTTCAAAAAAAACGATTAAACATAATAGAAGAGCTGGTTAGTCTCTGGTTGCATATAACTCAAAACTTAACCACCCTATTCCGC
ACTCTCGGCATCTTCTCTCCACGACTTCTGCATCTCAAATTCCTCCTCAATAGACAGCGGCTCGGATGCCGTCATCTCTGCGACATAAATACACAAAAAC
ATGAGCCCATGTACCACCAGAAATGGACAAGTTGAGTGCAGCGCTGTGCCTTGTAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGGCACATGCTCCT
TCTCGTACGGTACAAGCGTCACCTTCTGGCCGGTCTACAGTACAAGTCACACAGCAATATTCTTCATAAATTAACAGTAAAGAACAATGATTAGAAGTGC
TTATAGCGTACGATGACGACGCCTGCATTTGCCTTCATTGTGGACTCGGACGACTGAAAATGAGACGATGGTGTGGTGAACACGACATAGTTGGTGTGGT
GGACACCAAATTATTATCATGCCTTGACAATCACTTGTGGAAATGCTCGGATCGACGTCCGACGACGCACTTGAGGCGCAGCTTGCAGAGGTTTTACGTG
TCCTTATTCAACGCAGATGGGTTCAGGTATTGACCCGTGATATTCTTGTTACCATGATACGTTGGATTGACTCCGTATTGACGTGGACGTGTAGGTAGAC
GCAATAGAAGCTATCTCATGGACGAGTAAGAGTCTACGTAAGCTGATGGAGCATCAGAAGTTGCTACGGCTGGCGGTTCGAGTCGGCGGGTTTCCACCCA
TGTCCAGGTTTCGGTATGTGACATATCAATCTGTTGTAGACGTCTGAAGCTGACGTCTTGTTGAAGCTGTTGGCTGCAAGCTGGAGACGTGAAGACGCTG
ATGAAGGAGATCCCTGATGGACTGAGCAGTAGAGAACACTACTTCAAACTGGCAGGCATTAGGAGTCTGGAGGACAAAGCAGAGCTGGAGACTACGGGAG
TGGAAGGAGAAATCGATCGAGATATCGAGCGCACTTTTCCTGCGAATCCTTTCTTTTCAGAGGAAGGTTGGTGGAGCGTTAGTTTAAGATTGAGAAGATG
GTGGTCATTGATATTAATTTTTTTTGTAATAGGTGACGGTAGAAGGCTGCTGGGGAATGTATTGAAGGCTGTTGCTCTTCACGCCAGTGACATTGGATAT
TGCCAGGTACGTGTCAATTGGATAGGGTATTCTTGAAATTGAGAAGCTAACCGAGTCGATATGTTTGAAGGGGATGAATTACGTCGTCGCTATGTTACTA
CTTGTGGTGAAGGATATTCAAGCCGTTGCAGAACTGGACTTGTCGGATCAAGAGGCCGTCTTTTGGCTAACTATCTCCTTGATTCGGCGCAAAGGGATGG
CCGATCTTTGGAAACACAAGATGCCAGGGTTCATTTTTGTTTTTTGGGAAACTGTTTATTCGACTGAAAAAAGCTCATTTTGTGGATGTTCTCTCTTTAC
TCAGGTTATCGCAGTGTATTTACCTTTTTCAGCAGCTTTTGCAGCTTCACTTCTACGATCTATCGGCACACTTTCGGCATATTGGTATGCATTCAAGTAT
TCTCGTCACCCAGGTATTTAAATCCAGACCATCATCATGCTTTATTGAGTTACTACGTAGTACTTACTTTTGCTTCTACATGCACGTTGCAGTGGTTTGT
GACAGTGTTTGCTCGTGTACTTACCACCCCATCACTTGTGCGAGTATGGGATCTTTTCTTAATCGACGGTTGGAAAGCTGCGTATCGAGTCGCTCTTGCC
ATCACAGCGGAGTTACGACCGAAGCTGCTCGCAATGGTAAGCTAGCGCAAACACAAGGTTACTCTTACTTATCCTTGCTAACATTCTTTTTGCTTGTTGT
GATAAGGATTTGGAGCAGTGTAGCGAATTTTTCCGTAAGAACCCCAAATTGGGACTGGAGGAAGCGCTTAGTCCGGATGCGTTACTGCAGCGTGCACTGA
GCTATAAAGTGACGCGCAGTAGCCTTACACAGTTGAAGGAAGAGCGGCATCTTGAGGTACGATAATTGCAAGCTGTTCGCCAATCATGAGCATCGTGTCA
ACTAATTCTATGCTTGCATTTCTCGCAGTATCTCAGACTTCGCCTGCAACAAACGCCGCTTTCAGACGAGCATCGTATGCTGTTTCCTACTCTTGAGCAT
GACGGAGATGTCGCTGCTAAACGAAAGTCTCTGGAGTTGATCCGCTCTAAGCTGCAACGCTTTGACACTGATGTCGCGAGTGATACAGTTTTCCTTCAAC
ACAAGATTGAAGCAGCGGAGAAGGCCCAAGCCACGGCGATGTCAGTTCGCTATGCTATCGCATACGAATTATCAGAGGCGGCAATTGAGTTGAATGAGCG
CATCGAGATCAAAAACCGTCTGCGGTCAAAGTTCCGCAAGCTTATGGCAACGGCAATCACCGAAGCAACCACTGGATCTACGACAAGCGCTACATCTTCG
CTTTTTTCGACGTGGATCAATCCATTCGATTTCATTAACGAACGGATGGCAAGTTGCTTTGAGCGTCTGCCACTGCTTTCAAGCTACATTGATACTGGGG
ACGAGCTGCAGGGAGGTGATAACGACACTGACGACGAAGAAGATGAGGAAGCTTCACGGAATTTGAAGCATCTCGAGATGTTGGTGCCGCAGTTGGCAGC
GGAGTTGCGTCTGTTGCAGCGTTCGTTGGCCTATAACGAGCGCTTTTTGCGTCCCATGCTGCAGCGAACTCGTCGGCTCCAGCGTGATGCTCAACTTGCA
CGGGTTGAAGTGGAGGAGGCCCAAGTATTCAAAGACAGATTAGCCGACCAGTTGCTGCAGATCATGCTGACAAGTGAGAAGCTCAAGAACGAGCGAATGC
AACAGCTCTTCGCTGAAGTCGACAAGAGCGCTAACAGTGCGTGAGCAGTACGTATGCGATAAACGTTGGAAGTATCTACTGTATTACTACCGGTTTGGAA
GCAGGCACACGCTACAGTAAAAGTCAAGTGACGCCACAAGCTCTTCCTTGGCAACAAGCGAGCGCCCCTCTCCCTTTATGCATGCTTGGTTCCGTTCTGT
TGTTTGTCCAGAGGTGATCATACTTGAGCATGACCCACTCCTGTCAGAAAGACTTACTCGTCCTCCGTCACGACGTCAGCATCAGCGAACTCGGCCGCCA
CAGTAGGCTCAGCAGCGACGGGAGCAGGCATGCCAGGGCCCCA