Description :
From Genome Similarity Track
Location :
contig_13:945121- 948200
Sequence
3079 bases(100 bases per row)
CTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCGGTGGCCGGCTTCGCACTCCTC
GGGGTGGTGTATAATCGACTTTCTCCACTGCCGAAGGTTGTTTGGCGAGCCATTCTTGGTACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTGA
TTCAGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCACA
AAGGGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCA
AGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAG
CTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTGT
ACAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCACACCT
CGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTCG
ACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTG
TCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCTGGTAGCAATCTCACCG
TCTTGGCGAGTCCTCGAGGTAACTTTTCCTCAGCCACTGCACTCGAACCCAGGCTTCGCATCACTCGACCCGCTTTCTTCATCTTCACTCACATCGCCTC
CACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCCATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGCGTAGAT
ACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGA
GGGTCTGGAGCTCGGGCGAGAGGTCTTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATGCACTTG
TTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCT
CGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTC
GTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTG
TTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTG
GCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGT
CAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATC
TTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTC
TTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCAC
AGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAGCAG
CTGCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGG
GTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGGGCGAGGG
GTCGATGCGTTGCAATCTCGAGTTTCGGTGTAACATTCAAACTTTCCATATTGCTTTCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTCACC
ATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCAGGACGTCGTCCGGATCCTCGTTTCGAGTTCC
GCGTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGGAATACGGGGAACGCTCGG
CCGTCGTGGCGAATGCTCCACCCAGCTGTTGTTCACTTGTACCGGTGCCTCCATGCCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGGGTCGACAGT
TTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCGGCTCCAGCG
GCTGATGGTGACCAGTCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCATCGCAGTCAGCAGGGAGA