Description :
From Genome Similarity Track
Location :
Scaffold_440:9451- 10668
Transcript NameFunction/comments
Physo_145061reverse transcriptase

Sequence
1217 bases(100 bases per row)
GAGCGAACAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCTG
GACGAGATGTCCTCGACCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTAAGGTAGTGGTCATACGACTCGAAGAAGAATTGAACTCGTCCTCGC
TTCTGGATGAAGCTGTTCTGGAAAACACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGAACCCGTCGGATTCCCTGTATCAAGTGGT
AAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGCTGTTCGACACGAAATCGATCTCGTTCCCGGAACGAAGTAC
TGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCTTGCAAAGCACGAGGCGGGCATGGTGCGTGAGAGTACGT
CTCCACACTCTACGCCGACGTTATGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGTTTTCAACAAGCTGATGCCGCTACCATTCCGGCGCAG
ACGCTGATTCCTCGGAAGGGTGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGA
GGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCGGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTT
TAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCATACGCGCAAACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACT
GATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAG
AGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAA
GGATCTTCGCAAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGAT
GCGGAGTGGTGTTGGGA