Description :
From Genome Similarity Track
Location :
Scaffold_4487:945- 2195
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4487-snap-gene-0.1Myosin

Sequence
1250 bases(100 bases per row)
CAACGTCGTGGGCGTGGACGATCTCGTGCTGCTTTCCGCCGTGTCCGAGACCGCGATCCTCGAGAACCTCAAGATGCGCCACGCCGCCGACGTCATTTAC
TCGTACATTGGCCACGTGCTCGTGGTCGTGAACCCGTACAAGTGGATGGACATTTACGGCGAAGACACGATGCACGCGTACAAGCACAAGCCGCGTATCG
ACGTGCCGCCGCATGTGTTTGCGACGGCCGAGGAAACGTACCGCACGATGCTGAGCGAAGAAGACCACCAGTGCGTCATTATCTCGGGCGAATCCGGTGC
CGGCAAGACCGAGGCCTCGAAGCAGATCCAGAACTACATTGCCGGGGTCTCGGGCAGCGGCGCCGGCGTCGACAAGGTCAAGCGCACGTTCCTGGAGAGC
AACCCGCTGCTCGAGGCCTTCGGCAACGCCAAGACCCTGCGCAACAACAACTCGAGTCGCTTTGGCAAGTACTTTGAGCTGCTCTTTGACTCGGCTGGAC
GCCCTCAGGGCGGACTCGTGACCAATTATTTATTGGAGAAGTCGCGCGTCGTGCGGCCCGGCAAGGGCGAACGCAATTTCCACATTTTCTACCAGTTATT
AGCGGGGCTGCCCCCAGCGGCAAGAGACAAGTTGGGACTCCAGCACGATGCACGACCCGAGGCGTTTGCATACCTACGAGCGAGCGGCTGCTACGCCGTG
GACGATCTTAACGACGCGAGTGAGTTTGAGGCGACACTCCAGGCCATGCAGCACGTCGGCATCAAGCGCAAGCAGATCGAGCTCGTGTTCCAGACGCTTG
CGGCTGTGCTCCACTTGGGCAATCTCCAGTTCCGCGGCCAGCAAGTCGGCGACGCCGAAGGCTCGGAGTTGAAAGACGAGAGCCGAGAAACGCTCGAGGT
CGTGTGTTCACTGTTGGGGCTCGATGCGCGTCGATTGGAACATGCGCTTTGTTATAAGCTGCTCCAAACCATGGCTCCCGGCGGCAAGATCGAGAGCTAC
GAAGTGCCACAAAACCCCAGCCAGGCACGTGCGCAGCGCGACTCGATTGCCAAGAACCTGTACGATCGGCTCTTCGATTTCCTCGTCGAGCGCATCAACC
ACGCGCTCGATCTCGACCGCAAGGCCGAGAAGCACGGCGAGTTTTTGGACGGCACGCAGATGACCAAGATTGGCATTCTCGACATTTACGGATTTGAGAT
TTTCGATACCAACGGCTTTGAACAGTTTTGCATCAACTACGTCAACGAAA