Description :
From Genome Similarity Track
Location :
Scaffold_1793:945- 2109
Transcript NameFunction/comments
Phypl_g14159hypothetical protein

Sequence
1164 bases(100 bases per row)
GTGCTGCCATAGAAAGCGGGTTTTTGGCCGATGCCTTAGCCAATCCGCTGACAGCCTTGTCTGACGTGTCAAAACTGGGCGGCGTGTCACTGCCTCCACC
GAACCCTAGGCCCAGCTTACTCCAGTCGATTTGGTCAGTCGGCGCGCTCTTCACTTTCTCACTTCGGCTGGGCGTCGAGCCGTCGTCCTCTCCGAGCTAT
CTGTCTTCGCGGTATCGCCGTTTGGCTACTCGCCAGTACGTGACCTTCCTGCCTTCGCCGTACTCGCCACacttgtccacggcgaaCTacaccgcctcct
ccagcgcctgcggCTCTACGGTGCGTACTTGTGTCGCGGTGACTTCGTTGTTGATTCCGTTGAGGAACGCCTCTACGTATGACTCCGCTAACACTCTCTT
GCCGAACCCGATGTCCGTCAGGCTGTCGGCAAAGTCGCTGAGTCGTTCCCCGGGCTGCTGCACTCTCTTAGCGAGCCGCTGTTGAATCTGCCAAGTGTTA
TCGCGTCGCCCGTACTTCCGTCTCATCTTTCTGGTAAGCTGCTCGAACGTTCGCTCCTCTGGATCCATGGTTTCGCGAACTCCTATCAACCATTTGCTGG
CGCCATCTTTCAGATGTGCGGTGGCACCGTAATAGAGCTCCCTTGACGTCCATACCCCCCCCGTCTAAAGCCAGCTGCCGTTGGACTTCTTGTGGAACCA
TGGCGAGCCAAGCTTCCAACTGACTCGCTCGCGGTTCCCTTGAAGTCGTCAATCCAGAGTTTCTTCCGCTTGTTCCTCCGTGGCTGTTCCGCCGgcattg
ctgctggcgcggGTGGTGCCACagctggtactgctgctgttgctgccggtTGCTGGATGAATCGCTTCATCATCGCCCTCTGTTGACCGGGTGTCAGCAC
TCCCCACCATGCTATCGATTCTAGCTCATattcctcgccgtcgcctgcGTCTGGTGGGTTTCCTGGTGCCTGTGCCTCCTGCTGGGGTTGCtggcgtgct
gctccgccgtttcttccgtcttcttcgttgcCGTTGTCAGTGTTGCCCGCGTGGCCAGCGTTGCCAGTCCTGTCGGCctctcctgcagcagcaatcaTGA
CCCCGCTGCTGACCAGGATGCCGTcactgccgtcgtcgctgtcgtcgccaagTAGGCGCAGTTG