Description :
From Genome Similarity Track
Location :
contig_2:944651- 951281
Transcript NameFunction/comments
g654.t1hypothetical protein

Sequence
6630 bases(100 bases per row)
ACACCTCAGCTTACACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTACT
GGCTGGCGAACGCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAGA
AGGACGACGTCCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTCCAGCCCCGCCCTGCGCGGGC
TCCTCAACATGCTCCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCG
CTCCCCGACCTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGACCAAAAGCGTCCACGACGTCA
GGGCAGTCTTGCCGAGGGGTACCTTAAACTCCCATGAGTTCTGCGAGTGGTGGGTACCCTCGCCACTTCACCAGATACTGGTATTATTTTTGGCGGCGAC
GCCGAGCCACAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCT
TGAGGACGCTTGGAACGCGAATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCAATCAGGCGAGAACGCCTATGATCGTTCATGGCA
TGAGATTGATCAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGATCTGGCGAGGCTGGAG
GGTCAAGTCGACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGTGCACGTCCCAGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGTCC
GGTACGGCTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTCTTCGGAAGGTTGAGCGTATACGCTGGCCCTTCTTGGCCACGACTTTGAAAG
GTCCGATGAAGCGTGGGCGCAGCTTCGTCTTGAATACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTAATAAAACCAAGTCTCCGACTGCGTAA
CTTTCAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCG
TTGACAGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGG
TAGCGTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGT
GGAAGCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTG
GATGATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGA
CTCGGGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTG
CTCAAACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCAACTCATGGACTCCCAACACCCAGAGGG
TACAGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGC
TTGGGCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATACGATATT
TCAGATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGC
GCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCG
CGGATCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAG
GCTTGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGC
ATGATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGA
TAGTTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCAGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGT
CCGATGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTG
ATGCTCGGTGTCCCAGGCCCACTCCGCATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTG
GCGAGGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCC
CGATGAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACATTATTAGTGCGCATGCACTCGAGCACCGCTCGCA
AATGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCG
GAAGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACC
GCTGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGA
GAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGAC
ACAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTT
GGCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGT
TGGAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGT
GTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAAAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGC
CGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATT
AACGAGTGTATATAGCTGTTCGCTATCCACCCCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTC
TCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTC
AAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCTAGGATGCCTC
GGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGTGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAG
GGCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGC
CGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAG
TGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACC
TCCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATC
GAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCT
ACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAA
AGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCC
TTGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAG
CAGGGCTTCGGCTCGCCGGAGCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGC
GCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGT
CTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAAT
ACTTCCGTTCTGGCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTC
GTAACTCTTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCG
CGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGGAC
ACGGCCAGCGCCACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGC
CCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGAGCGTCGTAGACGCTGTCACAGCCGTCATCTTCTG
TTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCC
GGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAG
GTGTAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACC
TTGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCA
AAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGC
ATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATAC
ACTAACGGGTACGTGTAACCCCGTTACAGT