Description :
From Genome Similarity Track
Location :
Scaffold_144:94465- 95799
Transcript NameFunction/comments
g18460.t1POM62124.1 Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family [Phytophthora palmivora var. palmivora

Sequence
1334 bases(100 bases per row)
CACAGCTTACATGGAGTACATCTTCATCTTGAAGAAGAGCAGGGCCGTAATGAAGCCGAGTGCGCTCATGACACCGCCAAGGAAGACGGGCAGCTTGTAG
CCGAGAGAAGTTTCGACCAGCCCGGATCCGATAGCGAAGTTCAGCAACTGTCCGAAGCAGTTCGCCGAGTTGAGAGCTCCAACGTAGATCCCGATCTCCT
CGTCTTCGCCGAAGACGTGGATGATCACCGGCACAATGAGCGCGAACCACACTGCCTGCGTGATGCTGGTGATCGCCACGACGAAGACGTTGAAAGTCAC
GCTGCTCGTCCAGGCCATGATCATCAGGAAACTCTGCGGGATGGTCGAGATCGTCAACACCCACTTCACGCCAAACTTGTGCACCAGGAACGGAATCGTC
CACGAGTAGATGTAGCCGACGATGTTGAACAGCAAATCAGCGCGGCCACCGGCGATGCTGACGCCGTGGTTGTAAGCGTCCTGCTCCGGGGTGCACGGGT
CACAGGTGTCGGCGTTCTCGGCCGAGCCGTTGTACACCTCAAAGCCGAAGAACTGGCCCTTGTTGCCATTGTACGCCGTGTAGCCGTACTGGACGAAGAA
GAAGCAGACGCCGTAAATGGCAAGCACACCGGGGAGCGTGCGAACGCCATGGTACACGGAAGCGAAGGCGTGGGCGATGCGCTTCCAGGTCGACACGGCG
TCGACCTTGCTGGGGTCCAGAGGAGTCTCCTTGCCGAAAATCACAGCAACACTAATGCAGATGAGCATCGTACCCGACAGCATCCACATGAACTCGTGGA
GAGTCTTGTGAGCCGCGCCGAAGAACTCAATGTAGCCGGCGACAAGAATCGAGCCCAGAGTCGACCAGGCCTGGCCCAGAGCAGCACCGGTGGTTTGGCG
ATCACCGGCAAAGTCAGCAACGAGCAGCATAGCCGGCGTTTGCACGACGTTGACGGTGATGTCCATCCAGAGGTAGAAGAACACGGTGAGGATCGACGTC
CAAGAGCGGTCGGTCTTCTCGCCGTCTGCGCCGTCGCCGTGGTCACCAAGAGCTTCACCCATGTCGCGAGTGTAGCTCATGGCAATCCAGCAGATAATGC
TGAGGACGCCAGCAACAACCAGGAAAGGTCTGCGACGACCGAACTTCGAAGTGCTGCGGTCACTGAGAACGCCGATGCTGGGGCCGACCAGCACACCGAC
GATGGGGCCGATGAACTGCGTGATCTGCACAGCAAAGTTGGGCAGCATCGTCGACAGGTACGGGCCCAGAGCAGCCCACTGAGCCGACCACGCCATGTTG
ATGGCCATTCGCGGCATTGAGACCGCGAGCAGCA