Description :
From Genome Similarity Track
Location :
Scaffold_759:9446- 14403
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_759-fgenesh-gene-0.2MFS transporter (AFU_orthologue; AFUA_1G17480)
Pytiw_DAOMBR242034maker-piw_contig_759-snap-gene-0.8Transposon protein, Mariner sub-class

Sequence
4957 bases(100 bases per row)
CGGTTCGTGGCTTGTTGTGAGGATGAGAGTGAGACGCACTCGTCAAGTGGGAGTCGAGACAACGACCTGCGATTAAGGCGCCAGCCATCTGTGCGAGCCA
GTAGCACGCGCTCGTGAGCCCGCTCGTGCGCGCGTTGAAGACCGTGACGTTGAAGAACGAGTGGTAGGCGTAGAACCAGTTGCTGTACGCGAACAGCGGG
AGCAGCAGCAGCAGAGTCTTGCTGTGCGTGGGGCTGCGCACGATCTCCAGCGCGTTGCGTACACTGGTTGTCCACGACGTCCATAGCGACCTGTCATCGC
CCAGTGGCAGCTCTGGTTTAGCTGTTGATGTTAGGTGCACTGGCTGGCCATCGCTCTTCACCACGCTGTCCGAGTCTTGAATCACCAGCCACGCGAGCGC
CACGCCGCCGCCCATGAGCAGCAGGAAGACCGCGTACATCCCATCCGACGACGCAGCGCCAGATGGCGACGCGCTCTGGTCACAGTTGAGTGCAAAGCTG
ACGACGCCACCGGCCGTGGCGCCCAGGTTGAACACGATCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAGAGCGACGCGACGTACATGAAGTAGCCCGTGGC
GCCGAGCGTGAGCGCGCGCCGCGCGCCGATCGCCGGCACGAGTGCGGCCGCCAGCAGACTGCAAACCGCGAAGCTCAGGTACACGAGTGCGTTGCCCGCG
AACGCGACGCGCGGGTCCGCGAGTCCGCTGGCGAAGGACGTGAGCGCGTTGAAGAGCCCCGGGCCGCAGAAGCAAATCCACGCGAGCGCCTGCAGCTGGG
TCGTTGCGGAGTTCATGCTGCGTTTGTCGATTTTAGATAAGAGCATCTCCAGCGGATCGAGGTAAAATATTAACCGCATGGACCATTTTTATTCAATTGA
CGCAATATAAAATACTCCCTCTGTTTCACTGTATTTGTCCAAAATTGAGCGATTTGTTGTTTCACAATGTTTGTCCATTTGGGCAAGATAAATTCATAGA
GGAAAGCACCCAAAATGTGTTATTTCGATTTTTTAGCGGAAGAACGCGCCTTTTCAAACAAGCGCTGCGGGCAACTAAGTGACCTGGGCAACTCTCCATT
CCGACGAAGAGTCGCCTTTTTCGAATGGGGAAGCTCGTAGGCATCGCCACCATCATCGGTCAGTGCTGCAGTCGTACACGACTGCAGCGAAAGAAACACG
TCGTCTAGTTTTTCTATTTTAAGATCCGAAAACGACTTTTCGACAGCAACGACCAACTCCTCGTAGCTGCTTGGCGCCTCTTCGTGCTGAAGCGTTTGAA
TAGACCAAAAATAGCCCAGGTCCAGCACGTTAAAGTCTGGGCTATTAGGAGGCTGGCAGAGCACGCGCAGGTCGAGGCGCAGCTGGCGGTCGGCCTCACT
CACGAGCGGATCGTCTTCCTTGACGTGTGGCTTCGCATTGTCTTGTTGTAGGTGAATGACGTCGCGGTGGCTGCGACGCGGAAACTTGGCGGCAATCGCG
GGGAGAACGTTGTTCAGTAGCATAGCGACGTGCTCCACCCTCGTCACAGCAGTCACCGGCTTGGTTTCGATGGTTCCAGCTGAGCGGTTCTTGCTGGTTC
GCTGCGCGACTTTTTGCTTCACGAAAGACCAGATGCCCAGCTTTCCGTCAAACCAGCTATTCTTGGCAGCGTCCTTTCGCGGCCTGGCGACTGCTGCCAA
AAACATTACCTTGCCGATGAACCGCTTGCTTTTACATTGACTAACGTGACGCACAAAGTCAACCGTGTTAACATTACTCACGCGTTACAAATGTTAAATG
AGAAGCATACATACCGTAGTGGTAGCGGCTCGTTAGGAGACAGGTAGATGCGCTGCGACGCTCGCGTCATGTAGAACCATTTCTCATCCAGATGAATGAC
GTCGTACATTGGGGAATAGAGTAGCGTCGCCTCGTTAACGAACCGAACGACGAAAGCCATGCGCGCGCGCTTGTTCTCGTCCGTCAGCAGGGGCTTGATC
GCGTTGGTCGTCGCCACGATGTCGTTGCGCTTGCGCATTCTGCAGAGTGTTGAGGCCGATGCCCCCGTCACACGTGCCAAAGAGCGCAGCGTATACCGCT
TACGGTATGGCGCAGCCTCCATTTTCTTTTGCACAGCACCTGCATCAATCCGTTCCTTGCCTTTCTTTCCCTTAATTTTCGATCGCACATCCAAGAGATC
TGGCGAGCGGGTCATGGTGTCGCGGCCACGCTTCCAGACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGT
GCACACGATTCCAGTGCGTTCACTGTCCGTAAGGTTCTTCTTTCGGCGCTTGGTCTTGGCACTCATCTTCGACAATGAGAGCACCACCAACCACGCAAAT
GGTGAGTACTGTTTAAAATGATACATGTGATTGTATCCAATCATAAAGGTAAACCATTTATAGAGGCAAATTTGCGTGGTTTGAGCTGAAAGAAGCGCCG
GGTTTGTGCAGCAAGTATGATTTGTTAAAGGCAATTCAGTGTCCCGGGCGCAGATACTCGTGATCTTCGTGCTTCAAGCTGTCGTTTAAGCCCGCAAACG
TGAAAATTGGTGGCTGGCACGCTTCGCAATGGCTGTCGGCGTAAGCCCCTTCAAAAATGATGGTTTTGATTGGTCGATTACTCAGCTTGAGATAATCGGG
TGAATGCGTGACCAGGATTGGCTGAGAGTGCGCAGAATGGGCTTTATTTTACGGTGCTGTAGCCAATCAGGCTATAAAAATTGATCTTGTTTTGACTTGT
TTTCCAAAAATGAACAAACACAATGAAACAGAGGGAGTACCATTTTGCGAAAACAATATACCATCGGCGTATGGTTTTTCTTCATTACAAAACATCCACC
AATGAATCACTATCAGCAATCGTCCGAAGGCTTCTCAAGAATGACTGTTTGTGACGATGCTGTAACTCTAACTTTAGCCAGAGAAGGACATTAGAGAGGG
CACAGAAAGTCATTGGAGAGGGCAAGGAAAAGTCAGAGAGGAAATTTTAGAAAGGGACTTGCATGTGAGCTGTGGTGGCCGTTGCCAGCCACAGCACTGA
GGGTAGTTTTATGCCTCTGGCTTTCCATCCTCAATNNNNNNNNNNAAACTCACTCAGAGGAAAGCAAGCGTCTTCAAGTCCCTGTTGGCATCGTTGTCCC
ACGCTGACCTCCAGTCCTCGAAGCCAAGATCGAGACGACCAACCCACATTGCTGTTAATCACCGCCCAACATAGCTTTCCCGCTGGCTTTATCAAGTTTG
ATGAAGCAAGCGGGTTGGGGAAGATATTGTACAAAGTCACAGATGGTGTTATCCGGGTGCTGTGCAGCTCGTGAGCTGCATCTGTCCAGTCACACAAAGT
ATGGCAACTCTCGCACTGGGTGGGCGCTGGTGTTATAGGGTTCACACAGGCACGGAAAAGTGGTATAGTGATCACAGATCGCGACGGTCGCGCATAGCAT
CCACATGAGGAAGCGCACCACCTATCGAACCATGGCGATAGAGATGGTGATGGCCAACTCGACTGTCGCTGGGCGGGATGGAGTCCTGAATGTCTTCACC
AGAGCGACTAAATGTATGGTTTGGGATCACGCGACTGCATCCTCACTATTACGATGACCTGCGGTACTCAATGGCGCGGCACTGAAGATACCACACGGCT
GTCTTCATTTTGTCGTGAACGACGAAAGCAGCTGCTGTAGCGAGACGAGAGGGGGGGGTACTCCACCAGACCAAACGTACAAGCTTCGTGCTAGAGGCGT
CACTGCGCTCGCATCTAGTGACGTCATGTATGTGTTGTAACAGCTCGGCGCGATGGTGCTTATACTTGACCATGACGGAGGCAGCAATGGACATGCGTAA
TATCAGCACTGGAAGTGGTGCTATAGTCCAAGCGGTATCCCTCGAGGCTGATAAATGAGGACAGCGTGGGCACCAATCACAGCAAGGATTTTCTCTATAT
CAATGATCTGCTCACTCAGCCATCGTGCTTTGGTTGTTTCAGTAGCAACAGCGTGGTAACCGCTTGCTCGGCGTCCCCGTGCAGGGAGGCATCATACGCA
AGCACCATCGCGAGATCATATTCCCGATTGAAATTCACTGTGCATTGATGGACTGCGTCGACCTTGTCTGGCCGGACCAAATGGAGCTTGAAGTGACGTG
GGGGGGGGGAGGGGGGTCAGATGTGCATCTCAGACTCGAAAACGACCAACCTTGTCTTCGGCTGAGGCAGTCGAAGCACAACAGACCCGAGCTGCGGCAG
TGAGTGCGGAAGTGAAGCGCAAGGCTCAGATTTGTTTGCTTCCATTCTCGCTGTCAGTAGATTGACCGTGGCAATCAACTTTCGAGCCAGGATAGCCAAG
GCGGCCACACCGAGCAGTGTGGCATAGAATGCTCGACGCGCAGCACGGAGGACAGCC