Description :
From Genome Similarity Track
Location :
Scaffold_971:9443- 11157
Transcript NameFunction/comments
g16340.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1714 bases(100 bases per row)
CGGGGCCAGAACGACGCTGAGCGATATCGGTCGCAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCGTACGA
GCAGTACCGTCAAGCCGAGTGACATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAACAAGTACATGAGGAACTACAAGAAGATGGC
TCCGGTGGACGTGCATCTCGCGGACGACGGTGTGGTTCAGGCGGTGGGGACCGGCGACATTGTCATGTCGATGAAGACGCCACGCGGCATGAAGAAGGGT
GTGCTCACGAATGTGTGGCATATCCCGAAGCTGTCGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACG
GGTGCTTCGCGGACAACAAAGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGC
CAATGCGGCAAGTTCGAAGGATCGCCGAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACCTTGGCCATGGCGGTCTAGACGCCATCGTC
AAGAAGAGCTACGGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCGCTCGGCAAGCAAACGCGAGTGAGCTACATGA
AGTCGTCGCCGAACCGTGCGAAGCAAGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATACAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGT
CACGTTCATCGACGACAAGTCGCACTTCTGCGTCGTGTATTTGCTGAGGAACAAGTCCGAGGTGGCCGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAA
ACTCAGACCGGCAAGCGCGTGAAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCGGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGC
AGAAGTTCACGCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGGCCGCTGCATGCTGGAACATGCTGG
CTTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCTCACCAA
GTTTGGACGGGCAAGAAGCCGCTGCTGGCCAATCTCAAGGTCTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTC
GGTCGGTGCGCTGTCGGTTCCTGGGATACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCA
GTTCATGGAGGACGTCTTCGACAGTGGGAGGCGTGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAG
TCGGATGAAGACAACAACGAAGAGGTGGAAGAAGAGGAAGCTGCGCAGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCACGGACGCAGTCGCTGG
AGGAAGCCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACTCTGGACGAGATGTCGGCTGCGGCTCAAGAAAGCCAAGACTT
CGAAGCTGCGTACG