Description :
From Genome Similarity Track
Location :
Scaffold_2:94423- 99228
Transcript NameFunction/comments
Phypa_INRA-310PPTG_02102hypothetical protein
Phypa_INRA-310PPTG_02103hypothetical protein

Sequence
4805 bases(100 bases per row)
TTTTCTCCAAAGCATTTCGAGGCATTTTTGGTTGCCAAGATGAATGCAAGTGGCCGTGTCCTCAAAGTGACTACGCTAGGCGGCTATCGGAGTGCGGTGA
AGGACATTTACAGGCAGAAACGGGTGGCTCTTCCGGTAGAGTATGCAGACGATATGAAGACGCTGTATCAGGGATTTAAGAGAGTTGAGGCTACAAGAAA
CCAAGCCGGTGCTGGCGAGGCTAAGATGGCCGGTAAAATGGCGCTGCCATACTCTACATACACACAGGCCTGCAAGGAGACGCTGGTGCTTTCGGATGGA
GGTTTTTCGCATTTATATCTTACGCTTCAGTGGAACCTAATGTGTAGGTCACAATCTGTGGAAACTATTAACTCCGGCCATCTGAGTAACGAGGACGACA
GCATTGGAATTGTATTTCACAAGAGCAAAGCCAATCAGGACGGCACGGGACCTAAAGATCCTCGCCACGTGTACGCAAACCCACTGGCCCCTAGAACGTG
CTGCATAACTGCGTTAGGAATTTACTGGTCTTGTCATCCACGCCAAGGACCAGGTCCGATTTTTCCTGGGGCGCTACAGCGCAATCGCTTTCGAAAAACG
TTTGGTCGAGCATTGGACAAGCAAGACAGTGAACATGACTACGGTACACATTCTATTAGAAAGGGTGTGGCTACATACGCCTGCAATGGAAGCACCGGTG
GACCGTCGATTGTAAGTGTGTGCCTGAGGTGTGGGTGGTCTTTGGGAGGCGTGCAAGACCGTTATTTTCGCTATGAGGCCGCAGGTGATCAATTTCTAGG
CAGGGTGGTGGCGGGGCTTCCTGTGAACAGCGCTCAATTTGCAAGTCTACCGCCGCATTTCAAGGACAACAACTGTCCCATTGTTCGTGAGGGCGTGATA
AGTATGTTCCCGGCTTTTGCAGAAGACACGAGGTTACAGCCAATTCTGAAGCTGTGCTTGGCCTCTCTAGCCTACCACTATGATTTTTTGTCGACTGAAC
TCCCAACAACACATTCTCTTCGAGCATCAAGTCTATTTCGACGTTGTAATCTGCATCAGTCTTTATCTGACCAACTTGTTCAGCTTGAATCGCCCTGGAT
GACGGCGACTGGAATTCCACCCCAAGTTGTGATGTTTGGGTTACAAAAGGAAATACAAGCGACTGTATGTGCTCTACCTGAGTCTCTGGCTAGGCGGTTC
GCAAAGCTACTCGAAGAAAAAGGGATCTGTGGGAATGGCATCAATCAACAGCAGATGGAGGACACAATGCATAGGGTGTTAGATGAACGCGTTCCTCAGT
ACTCGCGTGCAATTCATCGTGAAGATGCTCCCCCAAGAGCAACCCTTCACTTCTGGCCCAGCGACGGCAAACTTCACGCGCTTCCCGAAAGCTTTGATTT
TCCGAGCACTGATGTTGTCCACGCTTGGCACTTGTGGTGGTTCGGAAGCGAGGCTGCAGGCCAACCTCCCTACAAGTCTCTGTGTACGCATGACCTGTCA
ACACGAAAGAAACGGCAAACGTACTCAGAGTGGCGCGTGATGATGGAGCACATTTCGTCAGCAATCGAGAGAAAGACTGGCGCATTACCTCCGCCCACAA
TGTCCGAGCAGCAGTCTGCAGTTCTGTGCGTCACTGGTGTAAACAGCCTTCCACTTGGCCCCTCCAAGCCATCACGGAGAGTCACCCAGTTGAAGGTCAC
GACGCTACTTCGCCTTGTGCGCCAGGTAGAACACAATAACAACCCAAATGCCCGTAGATTAGACTACAGACCCAGGAAAAAGAGGAAAGAAAACTAAATG
TACTCACTCGTTGCGCTATTGATGAAGATTGCTTCTCGTATCGCTACTGTTAGCGACTTCGCTACGACGTTCATTTTGACGAATCACAGCTCACTATGGT
TTTGCTGACGCACTGTCTTACAAAGGCTCGACACAAGTGATTGTCGAGAGTGAATCGGGAATTGCGCCCCCGAGTGCATCATAGAAAAGGCATTTTTTTA
CGCAATTCAATTGCCAGTTCCAACGTTTGTTATGCACATTTCCTATTTGCAGCGTAGTTTTATCTTTACAAACAGCATTTTCGAAACCTTTGGAAACTGT
GAACATGTCGAGCGCTCACGCTCTGAATATTTCCATCTCTCTGGTTATATTCGACGGAAACGACGCTCAGGTTTGTCTAAGAAATTCCCCTTACGTATTT
TAAGTCGAGTAGTTCTTTTTGGGTGGGTATAAATTCACGTGAATTTTTCGGCGCAAAGTGAATCTACTGCATAACTGGATATTTGTATCGACCCTTCATG
AAATTGTGGATAAGTACCCGGGCTCTTTCAAGGAAACTGAAAGACCCGTTCAGAGAATTAAGACCGGGGAAATGCTATCATTGTATAATTAGCAATAAGC
AACGGACTGTTACAGGCAATGCGTATTGCTATTGCTGATCATGATGGTCGTGGTACCAAACAAGTCGGAGAATCGTGCGTGCGACTTGGAAACTTTACCA
CCAGTACACTCGAGCATAAACTTAGCCTACAGGTGTGGTATGGCAATCGGATGACTGAACGCAATTACTCCATATTGAGACAACATTACTAAATCAATTT
GATCCACCATGTAGCTTGTTAATGCAACAATACACCCTGTGGACCATCAAATTTCCGGATATGTTGAATGAAGACACTTTCGAACGCGAGGGGGCTAACG
ATATCCTAGACTATACGCTTCGCTACGCGGAACAATTAAAGAGCGCGATTAAATGCCACATACCTACGCGTGATTAACATTCTCATCACGTTGATTGACC
GGAACATTGATCAGGAATGTACATCAAGACCCCTTCCAGCAAGATGACGCCCAGCACCACAGCTCAGCATTAACCGAAAGTCGAAGAAACGAACAGATAA
CCGTGAGGAGTGTGCGATTTATTCGATCAGATAAAAATCTAATCGGCGATCGCAATTGTTAACAGCCTTTGATTGGACTTGCTGCGCTGAGGAAGGCATC
CTGCTGCAATTGCAGATAAAGTCGAACTTGGTTACCGATGCTGTTCATAACCTGTTGAATACGACTAGCTGATTTCGTTCCACCATTTTTCACTTGTAGT
TTGTAGCAAAATCAAATCACCGATGCCTGTGAAGGATCCGATGGCGAAGGATCCATAACTGACCAATATTTGCCTTCAAACTCAAGTCCTTCGATTGGAA
GCAGCCACATCATTGAACCGACGATGACGGCTCGATCATTCTCTTTATATTTGCGGAACGCACTTACCGCGTCCACATACAAAGGTACCTGGCTGGTATC
TTGCATTAACAGGGATGCTATGCAGCTTATATCGTACTGATCGGCATGTTGCGGGATTCGCGCTCGTGCCTATCAATATAAACACAGATAGAAGTCAGTG
GGGATAACTCGCAATCATTATAAGAGTACTTACAAAAGAAAAAACCGTTTCAGCAGCGTTGTTGTCCTTGCTGGAGATAAATCGCCAGAGAAGATCCCCC
GCTTCGCATGCTGTGCATGCCAACGGCGTGATCGAGGTCATTTCGAAGCAGTGTCCACTCCCCACAATGTACCCGGTTTGAGTGTGAAACGTCACAGAGA
TATTTGGGCTCGGCGCCGGCAGAATAAAGTCAGCTTGTGGACGTAGATGCCCTAAATTGCTTGACAATTCAGATAGAATGAAATCGCTAAAATCAGGCTG
AAATACCGGCCAATCGACAATTGGTAGTTGCTTGAGAAACTCCAATTCCTGAAATGAAACACCACGTTAGAGTGTATCAAATCCAATCCTTCTTGAACAC
AGCCAATAAATACCTCATGTGTATCGATTTGTCGAAGTCTCTTTCGAACAGACTGGAAGACCTTGAACTGCCGCCTTAAATGGCTTTCAGTTTTTGGTTC
GAGTGTTCCGCCTGTATCCTCTTCTCACACTCGGCTGTCGCTCGATTTTGCCACTCTCTCAGTTCAATGTGATCAGCGCGCGATTTTGTGATCCGGTTTA
CCGGTTGAGCTTCGCTTGGAGCTTGACGAAAACGCGCCAACTTAGTCGTCAAATACTGTACTTCCAACCGTAGCGCGTGTAACTCAGCCTTCTTGCGACG
TTGAATGGCGGTGGAGTAAGGCACCAGGCTGTATTCTCTGCGGGCTGTCGTCCTCTCACTAACGAGCTCTCTTGAACGAGGCGCTTCACCGCCACCACTC
TCGACAGCAGTTAACTCAGTGTCGGAATCAACCTGCTTCGCTTCATCGTCGCTGCTGAAATTGCCGTATATGTCGTCTATCAGGTATGGCAGCCATGCTG
ACAACTCGTCGGAGACTCCCATCGATGACTAGAGTTAGTGTTAGTACGCAGTCAGGAAATTCAGAAGTGAGTTTGTTCCACAGAATGCAACTGTGGGTTT
AAGCCTTATTTATAGGCTCCGCTCACGCAAGCATTGCTCACATGATCACAAGCCATCAGAGATCAGTGATCACTGATCACTGATCACTGATCACTCCAAG
ATGATAAGCTTTGGAATTGTCAGAACTTGTAGCGGCTAGAAACAATACTCATTCTCCTCGACTTCCATGGTACTCGAAGTAACTTTCTATCCTGTCAAAA
AAAAAGTAAATTACCGACAAATCGACGGGGAAACGCGAGCTTTCCTACCCTAAACTGAGTCCAATTTGTCCAGTTGTTAATACACTGAGCCTATCTTTCA
GCGTTCCGTTTTTGAACTTTATTTTTGGCGAACTTAAGAGTGTATGTCAGGCGACTTTGGAGAGATTATTCTTTTACCGTATTAAAACAGGTTTGATCAC
CCTCT