Description :
From Genome Similarity Track
Location :
Scaffold_127:9442- 14684
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_127-abinit-gene-0.39Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_127-snap-gene-0.13TATA-binding protein-associated factor MOT1

Sequence
5242 bases(100 bases per row)
GTCGTGCAAGAAGGCGCGCCGTTGCTGCGCAGTGGTGGCGAAGTGAGTCATTATGTGATTTCATACCTTCAAACCTGTTGCGCCTATCCATTTGTATAAT
GCGCCATTGTGGGCTTGCAGGAGTACCAATATGAGACAAACCTGAACGAAGACCAGCGGAAGTTCCACGCGATCAAGCAGCGGCGACTGCTGCTGCGGNN
NNNNNNNNNNNNNNNNNGCGGCACGTCGGACCCGATTTGGACCACGCACGAGGACTCACTCGCCAAGCAGATCCTCCCAAAGCTCAACATGGATCGTATG
TACTACTAAAATAATCTCAATGATTCTGGGAGCTCGAGAAATCTTGAGGCTGATGTCAATAAACTCTCGTTAATGCCGTAGATGTGAAGGATATTGCAGA
CAGCATCGAAAAGGACGAAGAACGCGCTGGGTTAATGGAGACAGCACCACAGGAATCCGTGAAACGCACGCGAGCAGGCGATTTACTGCCGACTATGCGC
TCTCAACGACGGAGACTTTCGCAGACGACTGCGCCAGCAATGGATGCAACAAATACTAGTAATGTGGTGGCGGCATCAGCGTTGCTAAAGGGTGAGGACG
AAGGCGATGGCGACACTCTGATAATGACGCACTTGCACATTGTGGCAAACCTGCTCGCAGATCTATTCGAGTGTATTTTTGACGCCAAGTGGGAAGTTCG
CCATGGTGCGCTGCTCTCGTTGCGTCAAATATTTCTTGCGTCGCACTTCATCGAATCGCTGGATGCAAGTGGCGTGTCCATTTCACATGAACGTAACGGC
GTGGATTGCATTGAAACGTGGCTCGAAGAATGTCTTGTTCGTTGCATTTGTGTGCTCGCGCTCGACCAGTTTGCCGATTACTCGGCCGATGGTTCAGTGT
CTCCAGTGCGAGAAATCTGCGCACAGGTGTTTGGCATTCTTTTGGGAAGTCTACGCAGCGAAGAGCTTCTTGTCGCGTACCTGCAGATCCTGCGCACATT
GCTTACCGGTTCGACGTGGCACGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTTGGGATTGAAGTATCTCATGCAAGCGCATCGAC
CGCACGCGTCAGCACTGGTTCCACTCTTCTTTAACGATATCGTGGACGCATTCGAGTATCGACAAGAAGAAGAAGAAGTGATGGTGCTCACAGCGGACAT
GTTTGGCGAGTTTGCAATATACCTCGAGCGGATCCCTCACAGTCAACTTCAAAAGACAGCTGAGCTTTTGTGGAAAGCGCTGGCCGAGCACGCGAACGCT
GGACTAGTTCCTGCGAGCACGGTCCGCGCGCTGAGTGCGTGGTACAACCACCAACCGCTGCGGTCCATTCTCGAACAAAATCAAGGCTTTGCAGAGTGGA
CGTGGTCAAATCTGCATCACGTCGTCCCGATGATCCATCAGCCAATGCGGACAGTTCGCTTGAGCACCGTGATCTGCGCTGGTGCGATGTTTCAAAGTGA
ACCTTCGTTGGATTCTCGTGTTGCCATCGCGTTCGTACAGTACCTCTTGCCGCATTTACTGCTTCAGTTGCTGCAAGATCACGACGAAGATGTGCGATCT
CATTCGCTTCAAGCATGGAAAGCGGTCGTAGCGTGCTGCTCCAAACATGGCGTGTTGGTATCTGCTATTTCGGCAGAACAACTTGATATCTGGGTCAATC
TGCTCTGGTCCACAGAGGGTATCAAGCATCTCAACGCAGACTACGACGATCCTTCGAGAAAGAAAACAAATAGAAAGTCAAAGCATCCAGCGTTTGTGAT
AGTGAGAAGCGCGAAAGAAGACAATTCTGCTGCACAAGTCGCCTATGCCGACGCCATCGGGTTCTTGGGGTCTCATCTACCGTTGGCATCGCATTTTGTC
GGTGCAATGACTCGAAAGCTACTCGCTAGTGTGCAGTCAGTCTCTGGTGAACGTCAATGTGGTGCTCTCCTCGCAATATCTCACTGGGCTTTCTATGAGA
AGAACGAAAAGGACGATACAAAGGAGCACGAGAGGACAGCCAGACTCCAGTTCCTCGTCAATGGACTTGGACCCGCACTCGAGTCGATGTCAAAACAGGA
TTGGATGGCGCGTTTCTCACAAGTTCCTGGAAGTGGGAACACTGTGCTGTATTCGGAACAAGCTGGGCTACTGAAGCGAATTCGAATCATGGAGGCAAGG
ATCGTTGACATCTTCGCGGCCAGTGGCATCACTTGTGAGTCTTCTCCTCACGTGTTCTCTTCTTCTTCATCTGCTGCAGATATGTCGCGAGCGATAGCAG
AACACGTCGCGTTGCTCCCGTACAATAAATTATTGGACCAGCCAACGCAATTTGAGCTGGCGCATTTCAAACGGCAGGATCTCTTCCTCGTGGACGAGTC
AATCCAACAAGGTTTCGCGCGATTCTATCATCGAGTGCAAGGTCTTGGAACCTGTGCATTCTGCAACTTGCTCCCGATTCCCGAAAAGAAGAGTGGGTTC
CTCGTGAAAGCGCTGATGGACTCAATTAAGCAGGAGGAGAATGCAGATTTCCAGCGGCTTTCGGCACAAACCATCGCGCGGTTTGTTGTCTCGCAGGCTC
ATATTCAGCGAAAGTGTGTCGCGAAGATTCTCTCGAACCTTTGCAACAGCGCCGTAGCGTTGGTTTCTTCCGATCCAAGGAAACAAGACAGTCCGACCAG
AGATCCTGCATTGTCGGAACTTTTGCGAAAGACGGCGATTCGAGTTGAAGGAGCTGAAAATACATTGCGAGCCATTTGTGAAGCCGCCGGAGAAGATTTA
TTTCTGACGTGCCCAGTTTTGGGCAACATCGTGGTCAAAGCATGGGCGTCCTCTTCGCTGGACGATACCGTCATGCAGCAGAGTATGCATTTGATTTGTG
CACTTGTGCCCAGTATCCACACGAAAGCGTATGCACAGTGCTTAACGTGGCTCCAGCAGTTGGCGGCTCTCGCGTTGCAGCCATTTCAAGTCAGGAAAAC
GCAAGAAGCGATCGCGGATGCAATCTCGAGCATTTGTTCGCATGCAAATACTCATCAGAGAACTGCCATGCTGGTTCTTTTCCAGCATTGTTTCACTGTA
TTCAGTGGAAGCAGCAGTCGGACAACGAAGGATGAGCTGTTTGGGGCAATGCTGGTGCTGAACCGAATCGTCGGTGGCCTGAAGGCCAATGTAACGCCGT
ATATTCCAAGTCTCGTCCACTTTTCGATGAAGTCTATGTCTGTTCAAGATGCGGACGTTCGTTCGTTGGCGGCCAGAGCGTTTGCTGACCTCGTTCCACT
GATCCCTCTACAGATGGATCTTCAGGTTTCTTCTTCGGGCATGAAGCAAGAGAATGGTGTGGAGTTTGGATCTTCACGTGACGTTGTCGGGCAGAATCAA
GTGTCGCGAGAGTTTTTGGAGAATCTACTCGAGGGAAAAGCGGTGAAACATGTAGACATTAGTCCGCTTCTCTTTGGTGGTATCGCGCTTCGTTCGTACC
AGCAGCATGGAGTGGACTGGTTGTCCTTTCTGGTCGAGAACAACCTTCACGGCATTCTAGCAGACGATATGGGGCTCGGCAAAACCTTGCAGACGCTCGC
TACGATTGCAGCGTCGTCTCAACCAAATCAGGAAGACAAGCAGCAGTCGAGGACTTCATTTTGCTTGGTTGTGTGTCCTCCGGTGGTCGCCCACCACTGG
ATTACCGAAGCGCAAAATCGACTCCCTGACTCGTTTTCTCGCATTATCGACTACTCGGTGTCATCTGCTGAGAGAAAAAACCTACGTGAAGAGTTAAAGC
CGAGCAGAATGGCACGCCGCAGTACGCTCGTAGTCACGACGTACTCGATCCTTCGAATGGACATTGACTTTCTCAAGCAAATCGAGTATTCTTTCGTCGT
CTTGGACGAAGCGCATTTGATCCGAAACCCGACCACGTCGTTATTTGCGGCGGTTCAACAGCTACATGCGCTGCATCGACTGGCATTAAGTGGCACTCCA
CTGCAGAACAACGTCGCAGACCTGTGGTCACTATTTGAGTTTTTGATGCCGGGATATTTGGGAGAATTTGCACTCTTTCGGAAGGAGTATGTGCTCCCGA
TCTCGAAATCACGAGAGCGTAATGCGACACCAAAGCAAAAGGAGACGGCCGCGCTTGCGATCACGCGGTTGCATCAGAAAGTGCTCCCTTTTATTCTGCG
ACGCACGAAAAGCGAAGTGCTGAAAGAGCTTCCGCCCAAGATAATCACGAATGTGGTGGTTACTATGACACCACTTCAGAAGAAGCTGTATACTCTGGCG
ACCACATCAAGCTCCGTTCTGGAAGAGTCCGTGCCACGAAATAATGAGCTGAAACCACTTGCTAGTGTGATCTCGAATCTCCACTTACTGCGAAAGATTT
GTGTGCATCCCCAGCTAGCAGCGAATGAAGCCGGCATTTCCCAAAAGATGACCGCAAAGGAAAAGAAATCGCTCTCGGAATGGAATAGTTCTGGCAAGAT
GGTCGGATTGCACGATTTGCTGGTTGAGTCTTGCAATCTCGGGCGCCAAAGTGACGACGTCGAAGGACGCGAGATCGATGACGACTTCCATGTCGCGCAG
CATCGCTGTTTGGTATTTGGCCATCTCAAGGAAACGCTGGATCTGATTGAGCAGATGCTCAAGAAAATGTTGCCCCGAGTATGCTACCGACGACTCGATG
GTNNNNNNNNNNNNNNNNNACGCCGCAAAACCGGCGAGCGGAAATCGTCCAGCAATTCAACGACGACCCGTCCATTGACATCCTGCTTCTCACAACAGCG
GTCGGCGGCCTCGGTTTGACACTGACGGGGGCCGACACGGTCATCTTCATGGAACACTCGTGGAATCCGTTTGTGGATATGCAAGCGATGGATCGCGCGC
ACCGTATNNNNNNNNNNNNNNAAAACGAACGGTGCGGGTCTTCCGCTTGATCACGAAAGAATCGTTGGAAGAACATATTATGGACCTGCAGGCGTTCAAG
GAGCGCGTGGCAACCACGGTGGTCGCTGAGAATGATCCGCAAGCGAGCATGAACACGAACACGAAGGAGGTGCTGAGTCTTTTGCAGAGTTCGTCTTCGA
TCGCCAAAATGCAAGAACAAGCAAATGCCGCGTCGAGAGATTCCAAGAGAAAGAGTAAGGAGTTTGCTGGATCAATGCTTCCTCAAGGTGCCCAGGAGCT
CTTAGGCCACCTTGGCGATCTCTGGGATGAATCGCAGTACGA