Description :
From Genome Similarity Track
Location :
Scaffold_138:9442- 12931
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_138-fgenesh-gene-0.3Ser/thr kinase

Sequence
3489 bases(100 bases per row)
CCAACGCTTGTCGCCACGAGAATCGCCTGGAGTAGTTGCAATGCAATCTCCTTGACCAGAATCATGCTGTTGGCATCTTGCGCCAGCACAAACACGGTCG
GGTACAGGTCGTACTCGACGACAAACTGCACGGGCGACGTGTGGTTCTCAAATATACACTTGAGCATCTTCAACAGGTTTTTCCGCACGATAGCCTTGGG
CACGAGGCGTAATTTGACTAGAATCTCGTTCACAAACAACGCACTGCGACCCAGCGACTGATTGAGACGCACGGATCGCGTCAGCATGTCGAGCAATGGC
TCCAGCAAAATCTCGAGCTCCGTCTCTTGGCCCAGTCGAAAGAACTGGATAATCTTGAACAAATTGGCCGGGTTGCGTTCCAGCAGAGCGTTTTCCATCT
TCACCGTGTCGTACATGAGCCAAACGCTGAGTGACTTGATCGCGTCCACCTGCCAATACTTGTCATCCAGTAAATCGAGAAAGACAGGCACGGCATTGCT
CGCCCACAAGTGGGCACGTGACGTGGGCGATGCATGGGCAAAGTCGCACAACAGCGGTAGCGCAAACTGCTTGAGCGGACTCGCGCTTTTCACGACCTTG
ATCAGCGAAGGCACCACGCCTGCCTGCGTCGCATGGGTCTGGCGATTCCGGTTGAGACGGCAGAGGTAGAACATGGCCTGTAGCACGAGATTTTCAATTT
CGCGCCGTTTGTTGATTGAGATGCGGTTGGCGTCGTGGTTGAGCAAGCGCACGAGCATCGGAATGGTACCAGCACGATCAAGTTTGTCGAGCGTTGCCGG
TTCCATGCTCAGGTTGCGAACACACTTGAGCAGCTTGGTGACAATGGCAACGACCGGATGGTCGTCAGCCATGGCGTCGGAAGAAGGCTGCGTGAACGCC
AGCAGTGCCACAAGAATCCCTTCGAGCACAGCGCCATCGCACATGTGTTCTTTCACAATCGCATCGCCCTGCGAAAACACTAGCAGCACATCGCTCATGG
CGTCCAGCTCTTCCATTGTCCACGGCTTCAGAAGGAGCGTCGATTGCTCCACGTCGCTCTCCAGCTCTTCGTCGCTGTCGTCATTTCCGTCATCTTCCGC
TCCCTCCAGTGGGCAGCAATGCGAGAAGACCTCGCGAAACACTGCAATAAACTTGTGGAGCAACCCCGCTTTGACAAACAACCGGCAAATGTCGTTTTTC
GGAATGGTCTGCAGGCGAAACACGCTGAAAATGCCTTCCAACGCGATCCGCAGCAGCTCTTTTTGGTCCTTGACTGGCCGCGAACTATCAATGTGAAGAA
AATCCACGAGCACGGGCAAACCACCGCATGCGACAAACATTTGCAACGTCAGCGAACTCGTGCGACAACTCTGACGTACGAACTTTGCGGCTTCGAGGCG
CACGTATTTGGCCGAGACGTCACTCGCGAGATCATCGATGCTATCACGAATAGGACCGTAGGGTGGTGGCAGCGCTGCATGGCGTCGGGTGAGGCGAATC
ACAATCGGCACCAGGCCGACTAGTGCAAGATTCTCTTGGAAGCGTTTGTTGTCCTGGATGATCGTATTGACGACTCTCAGCACCGCGCACAAGACGTCAA
GTTTCTTCATCTCCAACGCTTCCATGATGTTGGGAATCACGCCGGGCTGCGACATGAGGTCGCGCCGAATCGCACTGTTACACTCGAGCACGTCTTGTAG
TTGGTTGCATGCGTCCAAAATCACTTGGTCTTCGAGGCTCGGGTCTAGCAGCGCCAGTAGCTCCATGACGCGTGCGGTCGCCTTTTGGTGCGTGTCACGC
ACGCTCGAGTACTCGAAATCCAGTTCTTCATCGTCAAACAGCACGTCAGAGGACTCGGCGGCGGCAGCTCGACGCAGTTGGAGTTGAGAGGCGCCTGCTT
CGTCAAACGAAAAATCCTCATCCGACGCATCGTCTTCTTTGAAGCGATCTAACGTCGTGTCAGCCGCCATCACTTGGCTGCTGGACTGGCGATTGAGTTG
TCGCCGTGCGACAGCGGCACGAAGAAGCTTGTCTTCGTCGACATCCGCGAATTGAAGGTCGTCGTCCTCGTCTTCACGGAACGTTCTCAGCTTGGACAAT
CGTTTTTCCACGGGGATGAGAGCTGAACCGCTCCATGCTTTGCGTTCGTCGTCCGCTTTGATACCCGAGATCGCCAGACTTGCCTGCGTCAAGCTCGCCT
CATCGTCATCCTCGTCCCACAAATCATCATCGAGCAACGCGCTGGCATCTTCTTTCGTGAGCTGGAACGCGGACGGTGCTGGGGATGGTGCGATGCTCCG
TGCTAGCGAGGACACCGAAGTCACACTGCTGCGCTCATGGTCGGGAGCTTCTAGATTACCGTGGAGGGAGAGTGGCGTGGGGTCCGACTCGACCCCAAAC
TCTTCATCCCAGTTTTCGCCTTCATCTTCTTCGTCCTTGGTCTCCGTCTCGGTCGACTGCTGCTTATCTTTGTACATCTGGATCGTATTGAGCACGGCGT
CTCGGTCATGCGATGACGTCACGTGCTGCACGACGAGCTGTGAGCTCTGCTCGACTTTTTTCTTCGGAATTTGCGCGATCCAAGGATGCTGCAACAGCTC
GGCCGCCGAGCTCCGAAGCCGTGGCTCCTTCATGAAGCATTTCATGATGAAATCCTGTAGCGCTGGCGAGATACGCTCGGGCAGCGGCGGGTGGTCGTCT
TGCACGATGCGGAACAGCGCGGCCATCGGCTGCAGGTCAAAGTACGGCGGCTTGGTCGTGAGCAGCTCAATGATCGTGCAGCCGACGCTCCAGATATCGG
CCGCAAACGACACGCCCGACATCTCAATCACCTCGGGTGCCACTGCCATACCCACACCAAGTCAGTATAGGTAACGCCCTCGTCCAGACCGCAATACGTA
CTCCAATAGGGTGAACCCACGACCGAGTTGGCCTTGTTCTGCGTGGTCTCGCTGAGCTTGACCGCGACGCCAAAGTCAGCGAGCTTGACGAGCCCGTCCT
TGGTCGTGAGAATATTGGCGCCCTTGACGTCGCGGTGGAGCACGCCCTGCTCGTGGAGGTACGCGAGCCCGCGGAGCACTTGGGCGATGTACATGGCCAC
GAGCGGTTCCGAGAACGAGCCGAATTTCTTCATGAACTGCGCGAGCGAGCCGTTCTCCATGTACTCCAGGACAATGTAGAGGTGTGACGGCGTGCGGATC
GTGTCAAAGTACGTCACAATGTTGTCGTGCGAGAGTTTCTTCAGCAGCCGCACTTCGCTCTCGATCGGCAGCAGCGCGTCGGCGTCCAGCTCGGCGAGCG
CGACTTGCTTGATGGCGACGGACCGCGCCGACCGCAAGTCGAGCGCGTTGAACACGGTGCCAAATCCGCCGCGACCAATCTCCACGCCCAGTTGCTGTGG
CAATGGAGGGAAGAGTTAGCATGAAGAGGGAGAATAGAGGAAGAATACAAGGGGAAACCAAGGCGTACGTAGTGGTCGCCGACGACGCG