Description :
From Genome Similarity Track
Location :
Scaffold_1166:9442- 10656
Sequence
1214 bases(100 bases per row)
NNNNNNNNNNCAATGCAAGGAGATTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGTGCCACGAATGCCACGTACGATGATGAGGACGGGAGGCCCAG
AGCCAGTGGATCTCTCGAATGCGACGGCTGGGAGTAACCCAccacgtggtggagctggcgtACAATGCTTCGTCGCGGACGCATCGGTCACTCTGCGCGt
gagtgcacagcacctgTGCACGGACAGCGAGACcaacgtggcgatgcagggCACCCCCTCGAAAAAAAAAGGACGCAGAACCAGTCACGCGTGTCGATAT
TGGACACACGTCAATGAGGAATTCAACCCCCAGCGAGACGCATTCTCACTGCAAGAAGCGTTATGACAAGCCAAACTTGGCATCCTGTACATGACTTCGA
AGTGAGTAGACTCCCTTCGTGCCTTGGTAGACTCGGGTGCGTCGAGCAACTtgcttcgacagcaaagtcTATCCAGCCTTGCcttcgaggaggtgcaaaC
CCCTCGAAGCATACTGGAAGTACGACTGACAACaggtgccgtcgtgaagaccaagaagcatGTCGTACGCATACGCTTCTCGTATCAACTAAGGAATTTC
TCGAAAATCTTATCGTCTGGACTTAGACGACAATTTCGAATTGGCGTTGGGCATGCCGTGGCCTGCACGACCTGACCCAAAATTGGACTTAAGAAGTGTA
CGATTGAACGGCTCGGTTGCGACCGCGCAACAATGAGGGATATCCCTGTCAGCGCAACCCATGCATCGCGAGATGCATGCGATCTTCCAGTAGAGACAGC
GCTGAACACTGCTGTCTCAACGCGCAAGGCGCGAATGAGAAAAACTCTGACGACTTCGGAAGTCGCTGGAAGTGAATGTCTGTCGATGCTGGGAAGCGCC
ACTGAGATCGGATGGAAACAGATTTAAAGGATGCTTCCGCCACAAAAGCACTTTGTGACGGCAGTGAGTCAACTCTGGGAGCTGATGCGAATTTGATTGG
ATCGTTCGGTAGGAAACGCCGCCAAAACGCGTCGAGACGACGATAGCGTATCAGCTCCGGGAGTTTACGCTGCGATCAGTGCGGACAGTTTCAAACGACC
AGCACGGGAAAATACTGCAAGCTCTCGAGCAGCCGGACTTCACGAAGAAGCGGATGCGCATCAAGCCGGGCTTAATGAAGCGCGCCAGCAGGGGCAATCT
GCCGGCGATAACAA