Description :
From Genome Similarity Track
Location :
Scaffold_830:9441- 13139
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_830-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
3698 bases(100 bases per row)
CAATCAGAGGGCCCGTCAGATTCCAATCCAACAATTAACTGATATAGAAGTATTGTTTTCATGAAATCAGATATGTTAAGAACCTACATTCCTCTTCAAG
ATCGATCACCTTGGCATCAATCACATGCATGCCTGTCCATGGCGCTTTGCTCATCGATTCATATCGCGCCTCGTGAGAGTATTTGCAAGAAGAGAACATT
GAAGACTGTAGTTGATTTCAAAATACTCCATCTTACATTCGACTGTTTATCTCGTTACTGGTACATTTTCTTCCTTCCTCCCATTTCGCTGACGGGAGCT
GCGCTGCGCTGCTTATTTACAATCGAGTCTCTACCTCGCCTGCCTGCACTGTTTAAAATATCGTGGGTCCCTAGTGTTGCTGCTGCTATTGTTTTCTTGG
TGTGCTTGTGTCTCCCGAGTCGCCGCCGTCTCGGAAGATAAAATTGTCTTGCTCGGCTTGTTTTCGTTCTTCCAGCCGCCGCTCAGCAAACTCGAACGCC
GTCACGCCAATCTGCCGTGGGTCGGCGCGCCGAGAAGTCGTGTGGCTGTGGAGTTGCTACAGCTGCTGCTGTCGTTGCTATTTTCTCTTTCTCAGATGGA
GTATCCGTGGGTCGGGATGTTGTTTTTGTCGTGTGCAGGATCGAGCCAAATCCGTTGTACTGTTGCGTCGCCTCGCTCTCTCTCTCTCTTCAGGTTCTTG
CGCAAAAATGGACTCATCGTTGCGGAGTCACCGCTTACTTGACCGAGCGCGGCTGCTGGATGGGGGCGAACATGTTTGGCTTCTTCCCCTGGTAGCCCAT
TTTCTTCTTCGGCAGACGCGTGCTCTGGTTGTTGTACTTGGGATAGTCGTTGTACTTGGTGGTGGTGGGCGTCGGCTTCTTCATCAGGATTTGGAGATCT
TCATCAACGTCCGAGGGCGAGCGGAGTTCACGCGACTTCTGGTGCTCCTGGTACAGCTCCTGGTGAGTCTCCATGAGCTCCAGGTCGGCGAGCATCGAGT
TGATTTCATCGACCTGTTCCAATTCAAGCAGCTCTTCGGACGAGAGCGGGTGGAACTTGGCGTCAAAGAGCTCTTCATCCGGGATCTCCTGCATCGAGAA
GAACGAGTCGGCGATCACAAAGCCGCTGCTGCCGGGCGAGTGCGGGTGCTCGTCGTAGTACTCGTCCGTGACCTCCGGGTACCAGCTGAAGGACGGGTAG
AAGGGCGGCGCGTTCACGTCTAGCGTGGATTTGAACGAGAACGTCGGCACGGAGGGTGGAGAGGCGACCATCGTGTGCTTGTGGCGTGGGGCTGCTGCTT
GGGGCTTCTTCTTGGGCGGCGCGCGGCAAATTCGGTTGTGAGAGAGAGTGAAGAAGCAAATGCGGAAACACGCGCGCGCATGCGGGTTCAGAACGTGACG
TCGCCTCCCCCTTTCTCTCTGCCTCGAACGTGGAATGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTAGCCAATGGGAGGGCGTCTCGAGCGCGAATTTTAACTTTAAAGCGCGGTGATTGGCGGAAGCCTCGAAGAAGACACATGGGGCGCAGA
GACCAGACACTGGCGAAACAGATTCTTAGATAATAGGTGGATTAGGATAAAAAGGGTTTTTCAAATTGATGATGGCTCAAATAAGTATGTATGCTACATT
AACAGGTAAATAAATGATGTGACCACGTATGTAAAATCGAACAAACCAGAGGACAAAATGCGAGAAACAGAGATCTTGGAGAGCAACTTCAAGAGCGTCA
CTGTGCCCAAAGCACTTGTAAAAGCTCATAAGGCAGCACCCGAAGTCCTTTTGAAAGCCACTGCCTACGAGCACAGCAAAGGCAGAACAACTATTACCAT
GGACGTCACCGTGGTGCTGTTCCGACGCTCAGTTGATGCTGCTGAACCGGATCTCTTCCCCTTTCATTCGCAGCCACAGGACAAGAGTTGCGAGTCAGAA
AATGCAACAAAAAGATTCAGAGAATGGCAGGAGCGAATGAATAAATGAATGGCTCCACACAAAGGCACCGCCACTTTTGAGGCGAAAAGGAGCTGTTTGC
GAAAAGGAGCTGCTCGTGGTCATCGGAGCTGCTGCCAACAACCCCCAGTCATTATGCTGCAGCTCAGCTGATCAGCGGGGAGGAGCTCGTATCAGTATAG
GTGAACTAATAAGGCCTTCGTCCAAGTAGATCCAGTCTGAAAATAATACCTGCGATTAGGGCTGGCTGAGAACGAAACCTGGTTCAAGTGCACAATCCCA
AAGATACTGAAATTCGCTCTCAAAATAAACATCGTGGTCCAAACACATTCTTGCCAAGTTGGCGTGCACTACGGAGCTCATTTCTCTTTTGTCATCACCT
CAGCACGATGATCACGCTAGACAGCCAGACAAAATAACGCAACTCGTCGCCAGCGACAGCACCCAACAGCATATTCAAGCGACGACGCATATGCTGCGCC
TCCACGGACCCTAGATCCAACCACCACACAGCAGCCTGCGAAAAAGGCAAAGCAGAGCAATTAAAAGAAGACCATGAGCAAAAGGCTTGTGTGGACTACA
ACTATGGTGTCTGAGCTTCTCACGCTGCGCTTTGACGACGAAAACATCAGCTGCCGAATCCGAAACGCCGACACATATGTAAAAAAGCGCTTGGCGTAGG
GTTTCTTCGCGAGCAGGCTGTCAGAGTGGCTCGAAGCTGTGCTTTCAGCGGGGCAGGTAGCTCGAGTTGTTCACACTCATTGTGCTCATCACTGAAGCTG
TCTCTGATCCCTCGCTGCAACTGTTTTGGATGCCAGTCAGGTCAGTGGAAAAGTACAAAAAGCTCAAGTTTGAGTATCGCCAAGGTCTCAACAGCTGAAA
TCAATCGGCAACATCGGGAGCGAGGACCACTCCGAGTACTGAGGCATCCTCGCGAATGCATTTGCTGGGAGATCTGGAGTGTCTGGCGCCATCCTCGCCG
ATGCTGATGACGAGACTGACTTCCAGAACGGCATTGCGTCTTTCTCAGCCTCGACGTCTGCGAAGAGCAAGGTTGGTGGACCAAACAATGAGCTCGCTAG
TGCTATGAAGGACGGAATGACCGCGTTTGCCGCATCGTTTGATTCGGACGATCTTGTACTTACCCTTGTGAAACATCTTCAGGAAGATCTCAAGAAAACA
CAACAGGCCAACCAGCAAATTCAAGAGTAGCAACTCGCCTTGCATCAGTGTTTCGTGGCAAAAATGAGCAAAGACTAGAGGTTTGGCCGCAAGATGTGCA
CACTGGATGAATAAATTTGAATACATTACACAGCTTGACATTTTACAATCTAAACAAGTGATCGGCGATGTCGTTCCTCTTTGCATGTCCTTGCTGGTGG
CTGATCTCGTCTTCGTTGCGCAAACTTGAGGTAGCTGGCTGTTGCGCTCTTGCTGACTCCGGATCACTGCCTGTGATCTGGACGCTGTCACGCATTGTGG
TTGTCAGGTTGTGTAACACCAGGCATCCAACTACTAGTTGCACTATTTGCTTTGGACTCTTCTGTTGCAGTTTTCCCATGAGAATTCAATCGCGGTTA