Description :
From Genome Similarity Track
Location :
Scaffold_1003:9440- 10688
Transcript NameFunction/comments
Phypl_g12019hypothetical protein

Sequence
1248 bases(100 bases per row)
CGACGAGGGCTGGTGAATATGGGGAACACGTGCTTCATGAGCTCAGTGCTGCAGGCGTTGGCGCATAATcccatgctgcagcactacTTTTTCGTGGCAA
GAAGTCATGATACGACCATCTGCCAGCAACAGAGACAACGGTTGTTGTTAAAGCGACAGGAACAAATGCAAGCTGTGAAGGAGAaagaagtggaagaaga
gcaggatgCCAAGCACGGTCCGGATCCTGCAAGCACGGTGTGTCTGGGCTGCGAGCTTGCTgccttcatggcgctgctggtaccGCCGTCTGCACATTTG
CCGCAGAAAACTTTGATGGCGTCGCCAATTGCGCCGCAAGGAATATTAGAGGCGATGTGGAACGCATTTCCGTCCTTCATTGGCACTGCTCAGCACGATG
CACACGAGCTATTGAttgctcttcttggtggaCTGCATTCACACACGCACCCCCGTGTATTCGTTCATGGCGGTGCCTCTCCCAGGTTTACTCCACGTGG
ACACAGTTTGTGTGACTGTGCTGTTCATCAGCACTTCTCCGGTGTGCTGCGATCTGAACTCGCGTGTGGAGGCTGCGGACAAGGTTCGCATAAGTTTGAT
CCGTTCCTGGATGTGTCGTTATCGCTGGATGATGGAAAGAGCAAAGGCCTCAAAGGTGAAAAACGGGATAGAAAAGAAAGTGAGGGACAAACGTCTGGGT
CGTGGTCCACGATAACACTAGAGTCACTATTGCGTCAGTTTGCAGCCGAGGAAGAGCTACGAGGAGCGAATCAAGTGTACTGCAAACGGTGCTCTAAGTA
CCAGACCAACTACAAGAGCCTGAACTTGCACACGCTACCAAATGTGCTTGTATTCCACATCCGCCGTCTCGACTTTTATCGCCAGCAGAAATTGATGCAG
AACGTGCAGTTCCCATTGGTGGGGCTCAACATGAGACCATTTACGTCAGTGGGGATCGATGAAGCCAGCGACCGCAAAAAGGGAGAGAGCAAAAGTGCCG
TACACGGGAGACCTGACAGTGATCAAAGTGAATACGTGTACGACCTTGTTGCAGTCGTGAATCACCACGGTGAGTCGGTAAACGGCGGTCATTACACCTC
TTACGTGCGAGATGAAGTACCAGAAGCTACAAGTCCCGTCAGCATAAAGCAACAGCAGTGGGTACTCTtcgacgacgttgaagtgaagaCTGTGCCAGCC
GACGAAGTTGAACACTCACAAGCGTTCGTTGTTGTATGCCTTGCACTG