Description :
From Genome Similarity Track
Location :
Scaffold_1812:944- 3516
Transcript NameFunction/comments
Phyta_totarag13697hypothetical protein

Sequence
2572 bases(100 bases per row)
TGCGTTTTTGTAGTGCTAGGCTCAAATATTAACCAATAGTAGGTTTGGACACTGTTGCTCAGCTGGGTTCTACATGCACGcaatattgtgaattccggCT
ATATTTACCCAACTGGGTCGACTTGTAAATTCACCCAAGCAATCAACAGACATctctcattggtcaaaattgaCTCGAATATTATTATTTATATCCTATC
ATGGTAGACAAGAGGCAACAACCAACTCGATCATGGACTTGCGAGACTGAAGACTCTGCTCGTAACTCTCCAGACGGCGTCCATATGCATCTCAGtcatg
ctgaagctgacCAACCACGGCAATTGACGAGTTTACGCAGTCGAGAGCCAGATATGCCGACTGGCTAAGACCATTGAATCGCTCTTGCGTGCGAGAGTCA
CTTGCGCTTAAGAGCCGCAAGACgcgtggaggtggtggtgctcgtaTTGCCTCATCCCACGTGGAGCGATCAAGACTACGAGTCACTTTATTCGCCCACA
TGCGCCAAACGACAGTCTCGCCATCGTAAGTAGCACCCACTGGTCCTGTAGACGACCCACAACCTCTCGAAGTGAGACTTCCGCAGTTGCACCAGCCCGG
TGAGTCTCAGTCGGGCGGATGCAGGCCCTCGGGAAAGCTTGATGATCCTGCTTCCTTCAGATTCCGACGCCATACTCGTAGATGAGAAGTGTGGTCGTCT
TTTCGTGCATAGATTGAAGCCAAATGTTCCAGTTTTGCTCTGCTTTTTTTATGTCAACGATATGtttcttgaccttgaacaGCATGAGTTTTCTCCAATA
GATGCAGGCTCAATAGTCCAAAAATTCTCAGATTTTACTGCCTGTCCATTCCCGTGAGAGCTGAATTGTTCCTacagcttctccagaatATCCTGAAACG
AAGTTCCGCCAGCAACAAAGGGATCAAGCCTGTTGCTGGAGGTGTCGTGTTCGCCTACAGTCGCCTTCACGATCGGCTGCACGACCAGTCGGTAGATGTT
AGAGGTCGCTGGCTCATAGGCTGTGTTTGAAACTGCGACGTCATTCTGGACGGGGGCACTCGCACGCGTTCTTGGAATGCATGTGCCAGTGATgtcggct
tcatcttgaagaaTACCAGaggaaagaagaaaacgttTTATATTGCGTATTATATGCTATTTCATAGTCGGGCGATTGGTCGCGCGACTGAACTCGCGCG
ATTCATTCAGTCGGCCTGGGAAATTTAgagtagaacccacaataACGCTTTTAGAAAATATAGAGCTAAGTGAGGGGATTCTGCACTCTTAGATACATGC
AGCTATCTCGTGCGCGCAGCCAATTAACAAATAGCGCACGTCAAGCCCATGCTGTAGTCGCCGGCAATGGCGTGGCGTGAAAATGTGAGTCTTTTGGGTg
ttggccaatgagagaagGGTTGTCCGTCACAGTGGGTAAACCGTAATTTTAGTCGCTCCGATACCGCATTCAACGGGCCAGAAAAACGTATTTATGCGAG
TTCatattttagccaatcaaaatttTGTGGTATCGTGCGCGGACCACGGACAGATAAGTTACGATTTTAAAGAGTAATGAAGCCGCAAAAGTATCATTCA
TCTGTCTTATCTAGCTCTACCAACTTCTGCTCTACAGCGAAATTGACTCTTCATCGGACCCTAGGATCGCGTCGATATCCCGCTCGGGCAACCTGTGCAC
CGTCGACTGTGAATTGGCGAAGCAGCCAAATCAGCGATTTCTAGTCTGGTTCGGCTtttgttgtcgtcgttgactGGCTTGGTGGTGCGTGGGCTAGACA
CGTTCATCAGGGATTTTGCCCAGGTGAGCAAGGCATCTTGAGCCCCTGCGGCATCACGAGCCAAGCCCATAGCATGCCGCTGGGCGTGCTAACTGAAGTC
AACGGCACGTCACTTTCTCGCATCAAGATTGATAGAAACCATCCATCAAGTCAATGGCGCTGTATTTGGTACTGCCAGACATGGTGTCAAGGACCATGTC
CTTCCGCGGGATCGGTGTCTGCGCCGGAATGGCGGCGTCGTTGAGCTTGTTGGAAGCGTGGGCAATCTGTCATCCGCCagtggccttcttcacgcagAAC
GTCGGACTGGAGTGCGGGGATAGGCTGTCGCGGACATGGCCTGCTTGTCGGCGactctcgaagaaggcgtcgatTGCTTCGACTTGATCACGGAGAAACG
GCCACTGCCGCGTCACACAGTACTTCGCGCAGGGCATGAAATCAATCTCATGCCGAACTCCACGGCAGGGAGGAAGGACAGCTGAAACCTTGTCCGGGAA
GATGTCAATGAAGTCGCGAACGAGGGGAGCGACAGGGTTACCGGACGCTTCGAGTTCCGGCAACGACTGGCAGCATATCGCGCTTCACGGACGCTCTTAG
GCTCAGCTCCTTTCGGGCGCGTCCGAGCATCGGACGCTGAATTTTCGGCACTGACttcgacgacagcgacggacgcagcgtcttctggTACGATCATGCA
GACTTGCTCGATCTCTCCGTCCTTCAGGTCGTGGAGGAAGTGTTTCCACGAGAGACAAGGCAGCTTCGTGAT