Description :
From Genome Similarity Track
Location :
Scaffold_123:94350- 96895
Sequence
2545 bases(100 bases per row)
CGGAGGTACAGTGATACACTCATGACTCCGCCAATGACTTCGTGTGTAGTTTGGTAAAGCGCACAAAAAGCGCACACGAATAGCCTGAATAATCCTTGGT
AACTCCGGTAGTATTTCGACGAGACCAACGAACATTTATAGTATGCATAGGGCCAATTCGAAAAGGGAGGAGTAAATATAAATTACCAAGGTGGCCAAGG
CTTTATAAATTTTTAGATGTTGCCCGGAGGTAGAGATTCAAGAGTTTGTACGATCAAGCTTAAGGACGAATACGAGTGGTCCATCTGGATGCGGGCGGAA
AACCTTGCTACATAGGCCTCAACTTTCTTTAAGGTCCGTGGTAGATGATTCAAACAACAGGTTTCTTTGGGATGTTTTATTGTGGATTTGAGTAGATGGA
TGATTTGAAGGTGCGCGTGTAGCTCTTCGTCACAAGAAGGACGTAATATGCACAACAGTCAAGATGTGATGTTGCGGACACAATACTACATTTCATCACA
GGATGAATACAACAATGAAAGCATTGAAGATAAGTATCCATCCGGCTTAAGCGATACAGCTCTTTTTTTTCTACAAGAAGAGATCCAAAGATGATTTTGC
CAGATCATTACATGCACGCGATGGTCATGTAAATGGCTGTTCTTTGTTCAGGTATTGCCTTTAATAAGTCGTTTTGTCTATACGCCGACTATAGTAATAA
TTCAGCTGGGTGGTATTTGTATAACAAGAAATGAGGATCCTATGTGTTATTACCGCCTATTATAACACCTAATTACCGATAAGACAATTAAGTTAGATCT
TCTTTCGAATACCAACCTCTTGCGAGAATATTAATCCATGATTTTGGATTTCGTAGGACATACAACCCTTAAACTTAAATTCGTTAAGCGGAAAGATTCT
GCGAGTGAATGATTGGAAGCTGGTTCTCTCGGAAAATTAACGAGCTATGTAATAAATCATTGGGACAAAGGATGTCGTAGCCAAATTTCTTATATTTAAA
TTTCGAGACCTCTCACGATGACGATTTTCTCGCTTATGAAGTATGTGATGACCCGCACTGCAATATGAACAGATCAATGCTACCCAAATTGAAATTATTG
AAGCTTCGTGTAATGCAAATTTTAATCCTGAATGTCAGCTCCCGACGCTCCACCGATGCATCTTAATCTCCTAAAAAACTTATAGTCGTGAATCTTTGAT
TTACCCGTTGTCACCTGGCAAGAAAGCGCCAAAATACGATCATGCGACGTATAAATTACTGGACACGTATGAAAACCACTATTATAGAACTCGTCCAAAA
TTTTATGACTTACAAGAGCCAAAATACGCAGTGAGAAGCAAGCCAATGTATTACTCCCAAAGAAAAGTAAATCATTCAAAGTTGGGCATGTGCATCTCAT
TGGAGATCAAAAGACTAAGAGTCAAGGAATTTAGGTCATCAGTCAAGCAATGTAGTTGCTCGAGGTGAGCACTGACCTTTTTATCGCGTTAAAGAAAGCT
AAAAGCTTTGATCTCGAGTGGTCGTGACGCTGTCCGCGACAACGGGAAGTCGTGCACGATTTAGTCTCTGAATTTACTTCATAGAGTTTTAATAACTATT
CAGCAGACATGGTATCGAGGCGATTACAATTAACTACCCTAAAAATCCACAAGTCAATGGAATACACAAATAGGTTCACCTTTAATTAGTAATCAGTACT
TTACTAGATAAAACGAGGAAGTGGTACGCACAACTTTAATTTCAAATGATGCCTTTCTAGTTAAAGTAAGCTAACATATCATTCTAAAGTCTAGCATGTA
CAGTAAAAGTCTTTAGAGATTAGTATTATACTGGCTGCAATGCTCGCTGACTGACCGTTCTGTCACTCTTAATAAATCCGCAAGTGCATTTAATAGAGTG
TCGGAACGACTACACGTGGCTTGTTGCCGGCTAAAAATATTCCGGCAACGACTTCGTGGTGTCCATCGATCCGATGAAGCTCGACTCCAGCTAGATTATA
AGGTTCGCGGGGCTGAATTCGATAGACATTCAACACTACAAGATTCCTAAGTTGTGCGCACGATATATGATTCTCAGGAAATGTTGACGAATGCGAAATT
CATCTTTATTTGAGGAAACTATATTGGTTGGGTTGTGCTGTCGTGTCAAAATTTAGCTTGTGCAAAATTGCATCCTTAACTGCTATGATTCGTACTGGAT
TATACCCTGCTTAAAAAGATTTTTACGCGAATAACGTTATCCACCTCTCTATTGACTCTGATTATCCAGGATCTATTATGTGATAGGATACACGCGTTTC
AAATACACTATGCATCAAACGGCGGTTTTCGGATAGCCGTGAGACAAAAATCTTGACAATGGTGTACATACGTGCTCATGCTTAAGTGCCAGAACCTTTC
AGACGTGTAATCGATGAATCTACGATGCTTCCTTTGTTTAGCTCTGAGAGTGAAGGAAATATTATCAAAGATATTCGTGTTGCAAGTTTCGCCCTACTAA
ACATTAATGTGATTTCCAGCTCTGGGTGTACATCACATTAATGTT