Description :
From Genome Similarity Track
Location :
Scaffold_4:94326- 99441
Transcript NameFunction/comments
Hyaar_Emoy2800757ATP-dependent RNA helicase DHX8
Hyaar_Emoy2800758T-complex protein 1 subunit theta
Hyaar_Emoy2800759T-complex protein 1 subunit theta

Sequence
5115 bases(100 bases per row)
GATCCTTCGGGATGGAATCAATAAGTTGGTTTGCCTGCGTCTGTCGAAGTTCACGACGCTCCTTTGCCAAGTTTGACTGAGTCATTGCTGCACGCTGCAT
CGATCCATCCGGGTTCTTCACAATTTTGACGGGTGACAAATCGCGGCTCATGTTAGTTTGACCACGAAGGAACACTGGTTCGTCCTCGTTTAGCTCCACC
TCAAAGTCCTCCTCCGTAGCTTCAGTGTTAAGCAGACCATGCTCGTCATCGAATGTTGGATAATCTTCAACCGATAACACGCCCGAGTTTATAAGCTGCT
GCACTTCCCACCGCTCAGGGGACGACATACGCTTAGCAGCACGCTGTGGCTTGCCGTCATCATCATCAATCTGGTGCGATTTTTGCATACCCGGCGCAGA
AGGGTTGACCCACGAGCGCGGATCCAACGACTTGTTTTCCTGCCGCACTCTCTCGACACCGCTGCTAGAGCGCTGAGGCATCAGGTCCTGCCCCGTCTTT
TGGTCAACGTCTCGCATCGACATCGACAGCTTGGCTCCTGATATCGAAATGAGTTTCACCTTGACACGATCTCCGCGCTGGGCAAACTTTTTTACATTGC
TCACACGATTTGCCGACAAGTTAGACACGTGCACAAGTCCTTCCTTCTTCTCTCTCCCGAGACCAGCGAGTTCCACAAACACGCCAAAGTCCATGACCTT
TGTCACACGACCATCATAAATGCCATACAGCTCTACATCTTTCACGTCGTGCTTGTCTTTCTCACGTCGGTCGTCATCACGAGCTCGGCTAGTGCTTTGT
GAATGAGTCGGTCCATAGTGGCCATCATGCCGTCCACGACCGCGACTACAGCTTCTTTCTTGCTCCCGTCGACCACTTCTCCTATCTTCCGACCTTGAGC
GTCTATTTCTTTGGACCCGCCCGTCCGTTCTTCCTCGACTCCTGTCACGTCCATAGCAGTCGCGCGCTCCCAATTGTTCCCGGGCTGCAGAATAAACATC
ACTCTTTCTATCACGACGTGACGGCGAGCGCCGTGCTCCTGTTGTATCTGCTTTTATCTCATCTCCATCGTCTTCCACTGCTGCTCCCGCAATATCCGCC
GCCGTGAGCCCCTCGTCGTCTCGGATCTCGTGCCTCGTGGTCGTCTTGCACTTGACGTCTCCATTCTTCTTCATCTTCATCCGATCCGGCGCCATCGTCT
GCACAATGCGAAAGAGATTCTCCGCCAGAGCACGGGGCAGCGGCAGCTCGTCCTCTTTAATCGACGCTAGGAATCCGGCGCAGTCGCTGCTACTACGCAC
GAGGTCAATGACAAACTCGGCCAGCGTCTTGTCGCTCATTCCCAAGTGATTTTCCAGAGCCTGGCACACTTTGGACACGAGACTTAGCTCCTGTAGCTTG
TCCATGATTGATCAAGCGAGCGAGCGATCGGTCAACGGCTTTGCGCGAACGTGCGCGCTAGAGTTGTGTACCACTGGTGTGGTGGTCAGTGAAGTTCATT
GATAGTTGATTGGTTATATTTTGAGATCTAGCGTATTAACCAATCGATGGTAGTAGCGACATCGCCAGCTTCATCTATTGGCTAGTATTGTGTGTGCATG
TTTGTCATCCTTATGACTCATCTTGACGTCGTACTCGCAGCTATTGACAAACACCTCAACTGGCCTCATTCCAGAGAGTCTAATGGATGCGCAGCTGGAC
AAGACCGATACGTCCCTCGCAATTGACACAAAAAGTCGCCATTCCCTAGAGAGCGTGCTACCTCTTTTTATTGATCGTACGAGCTCAGAAGGGCCAGCAA
CTGCGACAGGCGACGTCTTGACCGTCATGACTCGCAGTCCCGAATCTGCCGCGTCTTTAGCGCCGTCGTCCATGTCCTTGAAGGAGCAATGGCAGCCGAA
ACGTCACGTGTGCGAGAGGTCAGACTGCGGCAAGAGCTTTGATTCCAAGTGGGCTCTCATTAGGTGCGTTTTCGCTCTTTACTGTGGTTGTTGTCGCAAG
TCGCAGGAGGAAGAGGAAGAGGCAACAGGATTTTTAATGTGTACTGCTGCGACATGCAAGACACATTCGAGTTCACACGGGCGAGAAGCCGTTCCCATGC
ACGTATCCGTCGTGCGACAAGTCGTTTGCCGAGAAATCTGCGATGACGCGGTACGCTGTTAACAAAGTACTTCATAGGTGGATCTGAGAGGTCGTTGACC
TGGGATGTGTTGCTATGGACAGGCACTTGCAGACACATTCGCGCGACAAGCCGTACAAGTGCACATATGCAGACTGTACCAAGAGCTTTAAGGGCAAGGA
CTACTTGGAGTTCCATCTGAAAATACATGCGGAAGGGAACCCGTATGCGTGCGACCACCCAATGTGTTCCAAGACATTTTGTAGTCCGAAGAGTCTGAAA
AAGCATATCAGATTGTGGCACAACCCTGGCGGCAAAAGCACTTCAATGGAGCAACAGCTTAGGGAACGCATCATCAAGATGGCGACACGCAACAAGGAGA
AGACGCGCAAGTCTGAATCAACGATTCGGTCTCTCATGGAGGAGAACGAGTGCCTCAAGCGGAAAATATTTGAACTCGAGAGTTGCCAGCAGCGATTGTG
ATGAAGCGCAGCACTTGCGTTTGTTTGTTGGCCTGTTGAATCCCGCGTATGGAAAGTTGTATGGATGATTTATAGTGGGGGCAGGGATGCTATAGAGCAG
GAGAAGCAGCACGTATCATGCGCGTAATGCGCACATTTGCATTTATGACGTGATGCACGACGCCATGTACTCTGAACGGTTACACCACAAAAGCTAGAAG
TAGTTCATTCTCTTACTCGTTGAACACGACTCGTAGCCTGGCCCATCTTTGCTCTCACGACCCCGGGCGCACAGGTAGTGCGAGCTCACCGACAGCATAT
ACCGTTGTCATACCACTAATAGAATACCAACAGCATACTGTTGTTCAGCGCGTGTCAGAGATGTAAAGGCTTCATTTCGATTTTGAATAAACTACCTGAG
CAAAGAAACGAAGGAGAAATGCCAATCCAGCTACTGCACACGCAGAGCAATCGTTCGTCCTTACATGCCTCGCGGCTTCGGTCCACCTGCCGCCTTTGCC
ATGATAATCTGGTCCACACGCAACACCGTAATGGCAGCATCGGCACCAAGGCGAATAGCAGACACCTTCGTCTGGAGATGGTCCCAGATACCCTTGCCTA
GCGCATCTGAAATAACATGCGACTTTTGCTCATTCTACAACATTCCAAATACACGGCAACAACAGTCAGTCGTTGAAGACTCTTCACCGCATATATTGAA
AAACACGACGTACGTCCACATCCACACCAGCACTGCCATTGCCTACCGCGTGAGCAGCGTACAGGCTAGAGATAACCTCAGTCGCCATCTGGCCAGAGTT
CTCGGCAAGAATCCGGGGCACGACCTCAATCGCGTCGCCGAACTTCTTAATGGCGTACTGATCAAGACCTGGTGTAGCTTCACCATAGCTCTTGATCTGA
CGAGACAGCTCGATCTCAGTAGAGCCGGCACCAGCCACGAATCGGTCATCCCGACAGACAGACTTTACGCAATTCACACCATCATCAATGGCACGTTCAA
TGTCATTCAGCACGTTGTCCGTGCTAGCACGCAGCACAATGGTCGAAATCTTCGCATCTTCTTGGTCCTGCTGGAAGACAGTGACCTTTTTGCCGCCGAT
CTCCTTCACCATGACGCTGTCGCAAAATCCCATCTCATCAGGTGTTGGGGCACCGAGACGCACCAGTGCGTTTGCATTCACAGCACGGCAAAGACGACGC
AGCTCCCATTTGGACTGAATCTTGATCGCCATCAAATTGTACTTCTCCAAAAAGTGCAGTGCCATCTCGCTAATACTCCCACCCGAAACAACGACCACAG
CACCAGACTCGCTAATAGCGCGGATAGCTTCCTCCAGGTGCTTCTCCTCTCCTTTGTTGTAGTTCATGAGTTCGTCCGCGTCCTTGATGAGCACCGTGCT
CTTGGCCTCCGTAGACGAAATCTCAATACCGCAGCCATACACAGCAACCTTGGCCTTCAGCGCTTTCTTCACGAACCCCTCCGTATCACGCTGAATGACC
AACCCACGGATAACGGTCGAGTCGTGCAAGTTGCCTCCCATGATCTTTGCCACGCGGATATTATCCACATTAATCGACGGTTTCTTCGGTGCTGCAGGCA
TCACGTTCAAACACGCTTCAGCCACAAGCTGGGCCAGCAAGTCTTCGTATCCGTACTGTTTGGACGCCAGGGACGTCTTGATAGCCTTTTGCAGCGCCTC
ACGATCGCGCGGGTTCTTGACCTCCACCGTTTGCAGCTGCGGCAGAATCTCCTGACACTTGTCGTGCGCCTTCTGGTACCCTGTGACGATCTCACTCGCG
TGTAGTCCCATGCGCAAAAGACTCGCAGCTTCCATCAGCAGTTCGCCAGCCAGAGCCACCACGAGACAAGTGCCGTCACCAAAGTCGTTCTCCTGCATTT
TAGCAGCCATGACGACCATACGAGCAGCCGGGTGGATCACATCTAGCTCCTTGACGATCGTCGCTGTGTCGCTCGTCACGAAAATGCGCTCCAAGTGGTT
AATCACGAGCTTGTTCATGCCGTTCGGGCCGAGCGACGACCGGGTGATGGCCGCGAGCTGCTTGACGGCGTCGATGTTCTTGGCCACAGCCTCATCGACA
CCTTCGAAGTGTTTGTGGCCGTCTTTTAGTAGCGACGACAGGCCGCCGGCCACGTTTAATCCCATTGACTTGGACATGTTGGTGGACGGATGGATGCTTG
CGGTCTTTTTGGTTCTTGACTGGTTGAAAAGATTCCCCTTGTTGGTTTTTAGGTGGTCTTTATTGGGTGGGAGGAATCGATGTGAAGACGGCAACGAAGG
GGTGTTGACACAAATCACTTTATCGTACGGATAATGCTTTGTTTGCAAAACTTCTCCTCTTTGTTTGAGTTCTTTTCTTCAATGCAAATTTTATGTTTAT
TCTGTAGAGACAGCAGTGACATATTACGAATATTTACTTGGGGAAATCTTCCTCGAAAATGCTGCGGTACGAATCGTACTAAAAAAGCTAAGACCCGTTT
AAACTCATTGCTCCC