Description :
From Genome Similarity Track
Location :
Scaffold_1205:943- 4152
Sequence
3209 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCGGTATCTAGTTCGCTTCCCCGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGACTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGGCTTCGTCGAAATCCACCCGGTCGGATTCATCCACC
GAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCA
GCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTGCTTTCACCCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGTGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATTACCCCGGATCCTGTCTTGGGTGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTA
CTTATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGA
TATGCCATGATTGCTCGCTGTCGCTGCCCCAGGATCCGCTTGAATGCTTGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGC
TAGCTCCAAATCTTCGGAAGACACACTCCTCGTACGATTCAGCAATGGTTTGCGCCGTTCTAGACGCACTAGCTTTGGCTATCACGTACCCGGTAAACAG
GTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGAGGATATGATCCATGGCTATGATTTGGAAATGGTAAGTCGCTTGGATA
TTCCCAGGTGACTCCCCTTCAATTGTGGGCCTGCCCTTGCCCGTCTCACAATCCACACATGCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCA
GTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTT
TCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTA
GTCCGTAGCGATAATGCTGAAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACCTCTTTAGCCCTAGGATCCACGCTTCCTCG
TTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGG
CCATCACCTGGACTGTCCTTTTCCCGGACCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTC
AACCCCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATATATCCAACCGCGC
AGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACTTCGCACATGTCTGATCACCAAATTTGAATCCCCACAAA
TCACCAGCCTTTTCGGATCTTGTCCCCTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCGCTTCCCGCATAAGTG
GATCTGGCCCGTACGACTTCCCATCCAGGTAGACGCCACAGTATTGCACTGTACGCCCCGGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGG
ACGTACAGATCCTCATCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCT
TAGCTCGAGGAATGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGC
CCACTGTCCCAATCGTCCTTGTAACCCGGCCGACTTGAACAGCCAAGCCAGCGTAGAGTGTCGAGTCAGGATCTGGATGGATCTTCCCACCAGCAGATTG
TAATTGAGATCCAACACGCGCAAGAGCGCGAGTATCTCCTTCTCCACCGCTCCGTAGTTCAGCTCATTTGGCTTTAGCGTCCGGCTGACGAAGGTGACTG
GATGACAGATCCCCTCATGTTCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATAACCGTAGGTTGACGTTCCGGATCGAAATGACG
GAGGATAGGTGTGGTCGCGATCCTGTTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCACCATTTCCGAGTTCTGATCCGTCGT
CTCTATCCTGATTGGATCCTCTTTCCTTTGGTCCCGGGGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGA
TCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGG
CAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAA
CGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGA
GAGATTCCA