Description :
From Genome Similarity Track
Location :
Scaffold_176:943- 2525
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_176-fgenesh-gene-0.6[Skp1-protein]-hydroxyproline N-acetylglucosaminyltransferase, family GT60

Sequence
1582 bases(100 bases per row)
CTCGGAGACATTGAGTTGGCCCAGTGGTTGCTGAGCAAGCAAGACAAAGTCACGATGGACTTCCGCCATTATCCGAAACCAATGGATTGTGCCGCCAAGG
GCGGTCATTTGCATGTTCTGCAGTGGCTTCACGAACAAAAGCGCTTTCCTTACGCGTGCATTACGAAACAAGCGATGATCAATGCAGCGCAGTCTAGGAG
TCTCGAAGTAGCGCAGTGGCTCCATGAGAATCGATGCAGCGACGCCAATACAACTAGCACAGATGCAATGGATTACGCGGCTTCAGGAGGGTATCTCGAC
ATTGTGAAATGGCTCCACGAGAATCGAAGCGAAGGGTGCTCCACGAATGCGATGGATTCTGCTGCAAGACGTGGCCACATCGAGGTTGTGAAGTGGCTGC
AAGCGAATCGCTCTGAAGGATGTACGCAGCGAGCGATGGACGAGGCTACTGGGATAGTCATCTAGATGTGGCCCAGTGGCTTCACGCAAAGCGAGCAGAG
GGATGCACAACCAAAGCGATGGACCACGCCGCAATGAGTGGACATCTCGATGCAGTCAAGTGGCTCTACGAAAACCACCGCGAGGGATGCACGCCCAATG
CAATGGACCATGTAGCTGAATGGGGTCATCTCGACGTTGTCAAGTGACTGCATGAAAACCGCAGTGAAGGCTGTACGACCGAAACGATGCGGCTTGCTAT
AATGTGCGGACACTTTGGTGCCCTGCTCTTTTTGCACGCAAACCGCAGAGAAGGATGTCTTCGCGATACAATCTACATCGGCGAGGAATACATCGATCTC
TTGGAGATTTTACAGTGGCTGCATGCAAACTACCCTGACGCGGTTAATATGGACGCGTTGAGGGGCCGTGGTGACTATATGGCACAAGTGCTCGAACATG
TCTTGCCCTAGGTGTGACGTTTACAGATTAGAAAGGATATGTAGAGGTAGCGAAGAGAATAATGTGGAGAATGGGGAACTCGAACCCATAGCTATCGTAT
TCTGATTCTGAGTGTGTCTCTGGTTTATTTTTGCAAACAGTCACGTGAAGGACATTTTGCATCGACTACGAAATGTGTTCGTTATTTGTTTGGGCTTCAT
TTGCAAGTTGTTGATATTCCAACGCACAAAAATCAAATCAACCCACAGTTCTCACGTGGTAGGTGGTGAGAGGTCACTGCTCATGTGTATGCTGCCCAAA
GAATCTTCCTTGTTGCGGACCACCAAATCATCGAGCAAGGGATTTCTTGGCTACCGACCGCTGTGCTTTGACCGAGGGCTACTGTAGTGGTGGTCTTTGA
AAACTCTAAACTGGAGCGTGCACATCCACGGATTTACTGGACAACTCGAACTGGATCGGGTCGAGATTCCCCCATTCTGCAGCCCACGTGACCTCCTGCT
TCTCAAAACTCACACCGATGTGGGTCTGGTACTCGCTCAAGGTACGTTTTCCTCCAAGCGAGTATTTCCCAGCAGCTACTCTCGAGCCGCTACCAAACTC
CTCTGTTGAGTTTGCATCTGCATCGCTGTTGCTGTGATTGCCCAGCAGAAGATTCTTCACGTACACCTGCGACGCTAAGCGC