Description :
From Genome Similarity Track
Location :
Scaffold_3738:943- 2150
Sequence
1207 bases(100 bases per row)
TACTCTATCAACTAAAAGACATGTACTTTGGTCCTGGGGGTGACTTGGCGTCAGCAAAAGCGTCATTCGCCGAGCTCAAAAGCCGGGTAGCAGAAGCACC
AATTCTGCGTCACTTCGACTCGGCGAGAGAAGTCCACATTATGTTGTACGCCAATGCGTGGGCACTGAGCAGTACATTGATGCAACCGCACGACGACAAG
CTGCACCCAGTTCGCTTCTGTGGACGCGTACTAAAGGAAAATGAACTCGGCTATCATCCCGCTGAGAAAGAAGTAGTCGCGCTGTTACAATTGCTGAAAG
TGTGCTACACTTTATTGGCGGGGAAGACGCTACACGTCTACACCCGTTTCTCCACGCTGGAGTGGGTGTTTAAGTCAAAGTCGCTGTACGGCCGCGCAGT
CAGTTTTGCAGTTATGTTGTCGCCCTACGATTTGAAGGTGAAGCGAGTACGTGAACGAGACGTAGACTTCGCCCAGTTGCTCCAGGCGTCGATAACCCCG
TTTATCGAACTTGACGATTCCTTGAAGCACCTTGCGCCTCCCTCCAAGAACTCTGCGACAGTTCGAATGGGCCCAGAACTGCTATACGCCCGAATACCGG
CTGACTTTGCAGGATGCGTGCTGTCATTTGATGGCTCAGCAAAGACAGCTAAATACGGCGTGTATGGAAGCTGTTCGTGGATACTGTGGCGCCTTCCGAA
TTGGTACATTGAGGTCGCTGCGAGTGCGTACCTGTCGTCCACCACAGGCAACATCGCTGAGTATACCGGCATGAACAATGGAGTTTTGGCGGCGATTGAC
CGAGGGATAACCGATCTGATTATTGTCGGTGACTCCCGGCTTGCAATCCAGCAATCCATGGGGGTGATAGCATGCAAGAAGGAAACGTTGCAAGTGGAGC
TAGCTCGACATAGGGATCTCACGAAGCAGCTCAACTCGGTTCGGTATCGACACATAGCGCGACACTATAACGCAGCGGCTGATTCTCTCGCTACAGAAGC
ACTTGAAGCTAAAGCCGGACGAGTAATTCTCGGAACGAATAGGAAAGCAGAACTGAGAATGATTAACCGAGTAGCCGAAGAACTGTACGCCACAGAGTAG
CCGAAGAACTGTACGCCACAGACAACCCAGCCGAAACCCCGATTGTCACGGCAGTCACTCGTAGCCGAGTACGCCGAGTTCACTTTGAGGACGAGCTGGA
TGAAGAC