Description :
From Genome Similarity Track
Location :
Scaffold_21:94297- 98182
Sequence
3885 bases(100 bases per row)
ACCATTACGGATAGCGTCCACCACGCTACCCCCCCAACACCGCCTCACTCTTCGGCGATGTCGGCCTCTCCACGCGATTGCATCACATGGAACCTCTGCC
GGCTCCGTCGCTTCTGCTGGAAGTCGAACAGCAGATCACCACAGTTCAGGTGTCCTTCCTTGACCCAATTCGTCTCTGCGTGGCCCTCCCAACGCACCAA
ATATTCCTTGAGCCGTCGACCGTAGCGGGTGCGTCTCTCCGTCTTGACATCCAAGATCTCTTCAACTTCATACTCGTTGTCACCGCGAGTTTGTGCCTCC
CAGCTATCGTCGGGGAGAAGTTCTTCGTCAAAGTCAAATCGTTCGCTTTCATCAACAGTGAGATCTTCGGCGGGTCGTTCGGGGAACTGACGGACCAGCT
TCAGCTTCGAGATGTGTACGATAGGGAACAGTCGGTAGTCAGTCCCGCTGATTTCCAGCTTGGCAGCGTAGTCGCTCACCATGGTGGCGACTCTGAAAGG
CCCATGCCACATGTGAGCGAGCTTCCGAGCGTATCCGACCTTGACTCGGTCGAGGTACAGCCACACCTGCGATCCCTCCTTAATGGGTGACTCCGGTACG
TTCTCATTGTGGGCTTCCGCGCGACTCTCACGAGCTTCGGCGAGGAGACGACGAGTCTCTGTCTGAGCACGTTGGCATTGGCGTTGGATCTTGAACCTCC
ATTTCTGTGGGTCGAGATCTCGGCTTCCGGTCCCTCCAACAGCCAACGATGCCTCAATAGTCGTTTTAGGGTCCCACCCGTGCAGCAAAAAGAATGGCGT
GTCCTTGCGTACTCGGTCGTGCGATGTGTTCAACGCAAACACCAACCGCTCCGCATATTCATCCCAGTCCTGTTGGTTCTCGTCTTCAACGTACATCCGC
AGAGATCTGGAAATAGTCTGGACCATCCGCTCCGCTGTGCCGTTTGCTTGAGGTCTATACGCGAGCGTAGATCGCTGACGCTGGCCCAGCAGCGCATTAA
ACGACCGGAAAAAGTCGGACATGAAGCTCGGTTCCTGGTCGTGCCTGATTACTTCGCTGGCTCCGTACCGCCGAAACACGCATTCCTCGTGTGCCTCAGC
CACTGTTGGTGCGGTCCTGTCCGCGTTTGCCTTTGCCACAACGAAGCCGGTGAAGAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTC
GGGAGGGTGGGGATATGATCCATAGCCACGACCTGGAAAGGGTAAATAGCGGCGATATTGCCCGGCGATCGCCCCCGCAAGGTGAGTTTTCCTTTTCCCG
TCTCGCAGTCGACGCACTCCCCGACATACTTCTGCACACTTCGGAACATACCTCGCCAGTAGAAATGCCTCCGAAGCTTTTGGAATGTTCGGCTGACTCC
CTGATGACCTCCCTCCACACTTGTGTGGACATGATGCAGGAGATCTTCGTGGAGTGTACTCGGCATTACCAGTTTCACCATAGATCCACGTTCCTCGACA
TCACCACAGCGCCCCTCGACTGGACAGTACATCAAGAGGCCATGCTCGTCGACCTCGTAACTGTCAGCCAGGTTACTGCACGTCTTGGCTTGACGGCTCG
AGATCTGAGAGAGATCACCATGCAGGAAACACTTCAGTGACCAGATCCACACCTCCTCGTCTTGAGCACGGCAAATACGTTCCAAGCGCAGCTTCTTGAC
GACGTCTTCCTGCAACACGGCTGGTGCGACAGTACGAGATCGGCTTCGCGTACCTTCGGATGGGCGTCACGTTCTTCGCGCGTCTTGAGGAGCTCGTCCA
GTCGATTCAAGGTCTCGAGGTCCGTGTAATCGGTGTGACTCTCGACAACTACCCCGGCACCACGCTGCAGCGCCTGTCCCGCCAGCATATCCGCGGGTTG
GTTCCAATCGCGTTTTACGTGGATGGGTTCGCATTGCGGCCAAGACCGCAAAATCACTCTGGCCTTCTCACGCAAGAGCTGGAGTCCCGATGCCTTGCAC
TCCATCTCTCCACGTAGTTGGCGGATGACTAAATTGGAGTCACCACACACAATGAGACGGTCGATCTGGAGATCGGCAATCAAACGAAGTCCGAGAAGGA
GGCCATGGTACTCAGCCTCGTTCACACTGAGGTCCGGTAAATAGCCAGATTCAGCCTTGACAACCTTCCATCCAGGAGCATCCCATACCACAGCGCTGAA
CGCTCCACCAACTCGTTTCGGCTTGGCCGATGCGTCACAGCTGGCGACGCAAACGTTTTCTCCGGGCGTGAAAGTCGGCATCGGGATAGCCAATGCTCTC
GTCGACTTCTTCTGCGGAGAGATCTCCTCCAACGCTGCATCCATCTCTGCGCGCGGAGTGATACTGGCGGCAACCAAACCTAGTTGCTCATCTTCGCCTT
TCGTTAAACGTTCGATCTCTAGCGAATGGGGGGAGAGCAGCGCCGCGCACTGAGCTAGCCGTCCCTTCAAGCCTTTCGCGCGGAAGAGCCATGCGAGAGT
CGTGTGTCTGGTGAGCACTCGGATGTGTCGACCACTCAGCATGGTGAAGCAGCTATCGAGGATTCTTAGCAGAGCCAGTACTTCCTTCTCCACAATGTCG
TACCCGATCTCGTGAGACCGCAGTGTCCTACTCGTAAATTTGACGGGTACGTACACTCCATCACGACACTGAACGAGAGAGGCAGAGATCGCCCACTTGC
TTGCGTACACAATCACAACAGGGTCCAACTCTGGGGCAAAATGGTAGAGCATGGGTGCGTTGATCATCTTGAACTTCAGGGTATCGAAGGCTCGTAGCGG
ATGGCCCCATCTCACAGTCGCCTCGTGATTTCCGCTGACGTTTGTGGCTCGACCCTTGATGAAATCGGAATCTCCGAACCATACAACACTGTGGCATATA
CTGCGAAATCTTCGGTGAAGCGATTGTAGTAGTTGAGACTACCGAGGAATGACTGGAGAGCGTTAAGCGTTTTGGGAAACTTCAACGCCTCCAGACTTGC
CAAATATTTCGGCTTGGCGAACAGGCCTTCACCGGAGATCTGATGCCCCAGATAGTCGACTTTGCTCATACCCCAACTGCTCTTCTCCGCGCTAATAGAC
AGATTCCAGCGGTCACAAAGCTCTAGGAGATTCTTGACCTTCTCACACAGTTCGTTCCACGAGCTTGCTCCAACTAAGATGTCGTCGATGTAAGAGCGAC
GCCCCAGCACCGACGGCAGCGATCGATCTTCAGGAACACCTTCCTCGAAAATGTTGACGAGATCCGCGCGATCTTGACCCGGCGAGATCCGCAGCACGCC
ATGTAACGCATTGTCGATCAGCCGCAGATAGATTTGGGGGGCATTCTTCAGACCAAACGGCATTCGCAGCCACTCGAACAGGCCGAACGGCGTAATGAAC
GCGGAGATCTCTCGGGCTCGATCGGTCATACTCACCACCCAGAACCCACTCGCCATGTCGAGAGAACAGAACCACAGCAAACTGTCGAGATCTTCGAGGA
GGTCGTCAATCAACGGCATGGGGTAGATCATCAGTCGTGTCAGAGCATTGACCAGACGGTAGTCGATACAGAGTCGGACGTCCACGCCGTTCTTCTTGAC
GACGATAACGGTCGGAGACGCCCAAGGAGAAGTGGAGATCCGAATCAGCTTCGCCCCCAGTAGCCCCTTGACGAGTTGGAACACCTTTTCACGAAACTGA
GGCGGGATCCGGCGACAACGCTGAGCCACCGGTCGTGCACCACCAACGTCGATGTCACAGATCGCCCCCGTCGCCGCAGGGGGTAAAGCATTCCCTTTGC
CGATGAGAAGGTGACGCCGCTCCCAAATGATATCACGCAGACGATCAATCTCCTCTGCTGTGTTCTCAGTTGGATCCCCGAGCGG