Description :
From Genome Similarity Track
Location :
Scaffold_241:94293- 95920
Sequence
1627 bases(100 bases per row)
CGAGTGACCCACAGTTTCTCATGTTCCACCCACTCCAACCGATCTGGCAGCTCCCATGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGA
TCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAAGTATCCCATCCGCCACATCCAACCTCACTC
CGGCTAGTACCATGAAATTTATTTCCGAGGATAGCGTCTTGACCAGCAAGATCTCCAACCCAAATATCGAACCAGTACACCAAACAACCTGCCAACGTGA
CCTTGATTCGCGTTCTCCCGTTTGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGC
AAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCAC
TTTCCCGGGGCATGGTACTTCCAGTACCCACGGAACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTAAGCTGACCGA
CCTTAGGTGGATCTGCAGTGACCTCCTCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATC
CAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTAGAGATCTTGACAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGT
CCTGCTACCTGAATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGT
TTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAAGCATTGGCGGATCTGGTATTAGAATTCTTCCATCGGACACTTGCC
GACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTTCGGGATGACCTTTCTTGCCACACTTCTCACAAACCAGATGTTTCCAGCAT
CCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATAAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTA
CGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACC
GTTGGATCCTGACTCAGGAACTGAGTCAGGATCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGAT
CCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGCTCATCTGCGTCTGGAAGACGTAACAAGGTCATGTCGG
CCAGGTTCACATCTCCCAACCTATCGATGAAATGATCCACATGTTTCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAGCTAGGCCCGTAGACCGGC
CTCATTTAGTCGATGCAGGTATTCTAG