Description :
From Genome Similarity Track
Location :
Scaffold_7:942869- 945621
Sequence
2752 bases(100 bases per row)
TATGGCTTAAGCAAGCCAAGATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTAAACG
GTCCTATGAACCGAGGTCTTAACTTCGTTTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCTCCGACCTCAAA
CCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTTTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTC
AAAGCGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGACTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTG
GCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGGGTGTAGCCTGTCGAGGCGTGCACTGCATCATTTAATGCGAACTCAACGAG
TGCGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGTTCTGC
GGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGTACTCTGAAGAGGGACGTCCAGAACGTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATCG
CCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTT
GCTCAATCGGTCTACAAAGACCACTATACCCGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTTATGGACTGCCAGCATCCCTTG
GGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCACACACGTGCGTACATAGGTGCCGACCCACTTATACA
TCTTAAGCCATAAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATA
CTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGATTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTAACGATGCAGCCTC
GCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACCCTTCGCTCCCAAGAGCCCGTAGCAGTGCCACGCACATGTCGGCTTGTGCATACGCTC
CACGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACCCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCC
CGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGAC
GCATGATCAGTAAAGATCACAAAAGACTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTG
GATAGTTATTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGTTGACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCGAA
ATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCAATAGCGCAAGGATCGGAGCCTGAAAAAGGCTCTCCTTCACAGCCTCAAAGGCTCCG
TCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGTCGAGCCATCTCCGCGTAGTTTGCGCTGTACCTGTGCAAGTAAT
TGGCTAAGCCTAGCCACTTGCGTAAGTCCTTTTGATTCTTGGGAACCGGCCAATCCACGATAGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCTCGCTT
CCCAATGAAGCACCCGAGGAAAGGTATTTCTATTGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCT
CGCAAGTGGTCAATGTGGTTATCCATGTCTGACTTTCCGTGCTCTGCACGACTATGGACGAATATATCGTCAAAGTACGTCTGAGCGTACGCCCGGTGGG
GCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGAGTACT
CACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAACCATCGACCAAGTCGAGCGCACTGTACAACGTACAGCCTACCATGTTGTTC
TGCAGAGCATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTACCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTC
TGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCGCGCACCAGCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGATGTCACACTGCTC
TCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAATCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGG
TCTTTCGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCG