Description :
From Genome Similarity Track
Location :
Scaffold_850:9428- 10802
Sequence
1374 bases(100 bases per row)
ATCCGTCCGTTCTTGCCCAAGCTGGTTTCCGtcACCCAATATGGCTGGCAAGCAAGTTCACGACGTACGGGACGTTTtCCACGCCCTTCAAGCAGTGGTT
CAGCGAGGCGATGCCCcGGACACCAGTcTtGCCATCTCGCTGGATTTTGCTAAAGCCTATGACACCCTGGACAGACCTTTCTTGCTCGATGTGTTAGAGC
GGATCGGATGTCCTCCGCGCTTTCAACGAGCGGTCcGCATGATGCACCTCGCCACAACGGCAGCCTACATGGCGGATGGAGATATCTCCAGCGACGAACG
GGTCCTCAACGGCATCCGGCAAGGTTGTCCACTAGCGCCAACCcTTTTtGtACTCGCAGTGGATACCTTGTACCAAGCGATCAACGCCGCCAACACGGTg
CCAGGCATCCACcTCCCcACAGGTAGCACGATAGCAGTGGCcGGTTtCGCAGACGACACGAtCATCTACGTACAGGACGAAGACAGTATGCGGCCGGTTC
TCCAGCTCCTGGACGATTTTGCCGCAGCTTCAGGGCTCGAGATCAACCGCCATAAGTgcACGGTCGTCGCGCTGCACGGCACACGCCGACCACGGAAGAC
GCACGGGCTCCCACTCGCCGAGCCAAATGCCCTGCATCGGCTGCTCGGCGGCCAGATCGCAAGCGACATCAACGGCGCTCAGGTCTGGGACTTGACACTG
CAACAGATGCaCCTGAGGCTCCGAACAGCAGAACAGAAGACCACCAACCTCCTCCAGAGGATCAAGTTGGTCAACGCCATTCTCGTGCCCAAGTtCCTTT
TTGTAGCCCGTCACCATTGGCCCACCAGCGAACAAGGTGACAAGGTGCAGCGACTCATCAAGAACTTTGtCTGGCACAACCAGTTCACCGACCGCTCTGG
CGTCGGTCGGGCGTGGATGGGACCGACGGTGGCGTCCCTTGACATGGCAGACGGCGGGCTGGGATATCCcATCGTGCAGCAGTTACTtcAAGACCTCAGT
GTACAGaTAACACAAAGGTGTCGAGCGCCACACGAAGGAATTCGTTCTGAAATAGGTACTATTCGTCTGCAACACCACGCCGTGCCCCAACGCGCCTTGA
ACATATCACGtAAGCCAAGTCTTCGACCTACACTGCGCGGCACCATCGCCAGCACCGGCaTCAAGGCGCAGCTGGCATTGAACAGTCAGCCAAGagAGAC
TGATGAAATTGAACTCACCTCCCTCCTCATGACGCACGCCGGCAGAGGAACCACGGCAACAGCGAACTGGATtAAGGGCAGACTCCACTtCGACTACTCC
CCGCTTCGACCAGCGATGACAGCCCTGCGTACGTACCAACGAGAGCGATTCGGACATCTCCAAACGACAGCGCT