Description :
From Genome Similarity Track
Location :
Scaffold_21:94271- 101391
Transcript NameFunction/comments
Phyke_g1374hypothetical protein
Phyke_g1375copper-transporting ATPase, putative
Phyke_g137660S ribosomal protein L6, putative

Sequence
7120 bases(100 bases per row)
AGCAAAATCCACTAAGCGACGCTGACATGATACACAAGGCTATCTGTGCTCGACTGCGCTCCTCGGAGTGTCAAACGAGAGGCTGGGTACTGGACGGGTA
TTTTCTGGAGCATCGCGAGCTACACCGTAGCCTTCAAGACCTCGAAGCAGACCGTCATCCAGCCACGGCTGAGGGCACATCGCAGAGCATTCAACCTGAC
ATGTTATTCAATCTAGAGAGTAATTTCACACATGTTTGGCAAGAACATCAAGTCCATGCCAACAAAAGTGAGCTCCACTCGGCATTCACACACTGGCATC
AATATCGCTTGGAACTGCTCAATACGTGGTCTCGGCTTTTTGGCTGCTTTCATGTGCGCCAACTGGACAGCTCAAATAATTCACTTTGGCATGTGGCAGC
GCAAGCTCAAACATTTCtcaaggagcagcaacagttaGCATCACTCCACGCTACTGCTCTCACATCAAGCCGTGCAGCCAAGTCGCTTGGCGTAGTGCGC
ACACGCGACCAGCTTCAAGCACGTCAGCACCCGGTCTTCCAGATGTTCTGTCCAGTTGAGCTTCGCGCTGGGAAATTCTACGCATCTCATCTCTCAAGGC
GTGAGCACTGCATTGACTTCCGAGGTTTTAGTTTTTGGCTAGGAAGCCAACGAAATACCGAGCAATTCATCGAGAGCCCTGAGATCTTTGTTGGCCATCT
TCCAGGAGAAGCCTCCACACCGCGAAGGCAAGAGTTATGGCCcactcaagaagaagctgagggCGAAGCGCAAACAATTGTAGCTAGAGCACCGGTGGAC
GCGTCGTTACTGAGCCTCCTCACCGTGGCGGACTGCGACTTCCCTGAGCTAAAAGGCTACTGCCCAGTCACATTCGCGTCGGGCTCGGGCGCTAAAGATT
GGGAAGCACTTCGTCATGGTAGCGTCTTCTTCCGCGCATCGTATCGGTCCAAGATCTTCTTTTTCGTCTCTGAAGAAGCACGCCGTAAATTCTGTTACGA
GCCATCTCGGTACGCGTCACAAAGTTTGCCAGTGAAGCTACCACCCCAAGTCACACTGTCTAAAAGCTATCCAGGCCAATTGGAACAGCAATTGGGGGCT
GCCCTCAACGAAGTGTTGCTTGCACTTGGAAGTGAACGTCCAAAGTTCCCACAGGTGTCGACTCGTGCATCTGCCTGTGTTTATCTTGCTCTCTCACTCA
AGGCCCTCCAACGACGTTACCGGTTGAAAACGAAGCCTAATCCACACGCAGGTAAGACTCGAGACAATGACgagcaagatgaagagcagaagcaacGACA
AGAGCGGCGTGAAGAGCAGGCAGAGCGAGATGCCATTGCCCGTCGTGATGCCTTTGTGAGAGATTGTCAACTTGGAGAACAGATCAAGGTTGCATCCACG
CCTGCAAATACTTCCTGCGGGTCTGGAGCTAAAGTGGTTCGTACCATGCGTGCAGCTCATGACTCATCGGCTGAGAGTCACAATGATGCACAAGAGCGCG
CCGGTGCAACACCGGCCGGCGATGAAATTGAGCCGCTATGTCACCGCTTCGATTTCATCGTGTCAGGAAATGATAGTGGCGATAAGGCACTGCCGGTGGA
TATCCACGTTACGCGAACGCACGCCAAAGCCGCATTCCTCGAGTACACCTAGAATCCCTATAGTTAACAGAACAGAGTCAACAAGTTAGTACGCAAAACA
CATCATCCAACACCCGAGAAACCAGGTCGGGGACATAGTGCTGCTTTTGTGGCAAATCGGATTTCTCTGTTTGTTGTTATTCTTCGTGTCGCTCCTGCCA
TCCTTTCTGCTCGTCTTTCACATGCAGAGTCGTGTTGGTCCCTGAGTGTTACTTACACGACCCCTGAGACAATACTCGCCGTGGTCGCTCCATGATAACC
CTCACTGGCATCAAAATGTGATGGCATCAATAGCTGGTTGCCAATCGGTTGCCACCCCTTCAAGAATGCTCGTCATGCTTGTCATCGCGGGGCTTGAAAT
ACAGAATTAGTCGCAAAATATGCAGTGTCGTGGGAGCATGACTGGCGAAAATTCCCGCAGCAAAATATATCGATCTTAAGCATTGTCTCGCTCGCTTTTG
GTGCTTAACACCTAACTATTGCTGGTGCAATAGCGGCGTCGACTCCGACACATCGATTACCACGTGATTCTGCTGCGGTAGTCCCCAGGCACCCCCGTAT
GGTGGCTTCCAGAAGCTGAGTAGCAGCGAGAAGAGGATGACAGGCACGGATGAGAGTAGTTCCGAGAGCCCAGCGAGAGCCGGCGGAATCCAAATCCCGA
ATGGAGCGTACAGCACACCACATGCCACTGGCATCATGAGCAGGTTGTACATGAATCCCCAGGCAAAGTTGTGCTTGATGCGCCTGTTCGTGACGTTCGA
AAGCGCGCGCGCGTTCAACAAGTCACGTAGGTCGTCCTTGACCAGCACGACATCAGCGGCATCGAGTGCCACATCTGTGCCAGCTCCAACTGCAACACCG
ACATCGGCCGTTGCAAGAGCTGGTGCATCATTCACACCATCACCGACAAATGCAACACGGCGGCCGAGGCtttgcagcaagcgcacTTTGTCCACCTTTT
GATGAGGTAGAGTTTCAGCCAAAACAGAACCATCGGGTACACCCAGAGAAGCAGCTACGTTCAATGCTGTACCGCGTTGATCACCCGTCACAATCCACGG
CTGAATGCCCTCGcgcttcagctgctcgaTGACACGCTTAGCTTCAGGACGTGGTGAATCCCGCAACGCGATACTGGATAACAATACACCATTAACCACC
ACGAATACCACAATGCAACCTTGCGCTTGGAAACGCTGGTTGGTATCGACAAATTCTGAGGGGATCTTTAGAACACCGCAGTCACCTTCTGTACGCTGCG
TAAGCCACGTGAGTGAGCCAATACGCACGTCAACACCACCCACAGTGCAACGCACACCACAACCTGGTACTGCCTCAAAATCCTTTGCTTCCTCGACAGA
ATAGTCGTGCATTTGCGCTTCAGCGTGCGCTACAAGAGCTTTGCCAATGGAGTGCTCGCTATCACGCTCAGCCGAAGCCACGTAGCGCCAGAGCTGTGCT
CTGTTGATGCCATCGCTTGGCGTGAAAACATTCGCAACTCCAAGCTGCGCAGTGGTGAGAGTTCCTGTCTTGTcaaacacaacaacatcCACGTCCTCCA
GGGCCTCTAGTGCGCGGCCACCTTTGAAGAGTATGCCCACTTGCGAGCCCTTGGTTGTAGAAACCATCACAGCCGTAGGTACCGCAAGACTAATGGCGCA
TGGACAGCTAATAACCAACACTGTGATAGCAAAGCGCAACGCAAACGGAAAAGGTGCCCATCCCTGAGTATCCACATGGCCGTTGATAGCGAGCCAATAC
CAGAGCATGAACATACTACACGCCACGATGATGATAAAAGTAGTGAAGTAGGCAGCCACAACATCTGCGATACTTTGGCGCACGCCACGAGAGGCCTGCG
CTTCGCCCACAAGCCGCACCATACGTGCCAGCATGGATTCGTGAAGAGTATGCGTCACCCGCATGGTCAACACGCCCTGTGCATTTATGGATCCTCCAAT
CACTGTTGCTCCAGATTCCTTGGGCACTTTGCGAGCTTCACCCGTCACCATAGACTCATCCACCGAGCTTGCACCCCCCACAACTACACCATCCGTAGGT
ACTCGAGTTCCTGGTAGAACTTTCAGCAGATCGCCgcgctccaccagcacaacGTCAATATACAGTTCTTTCTGGCCGTCCTCCTCGAGCAAAATGGCAG
TCTTAGCTTGCATGCGTAGTAACGCGTCCACGCTATTGGAGGCGCGTGCTTTCGCAAGTGTCTCAATGTAGCGACCAAAAAGGATGAGCGTAATGAGCAG
TACCGTGACCTGAAAAAAGGTATCGGCCCTGATCGGAGCCTCCTCTTGCTCGTGAGGAGGAGGCGACGCCAGCCCTATCACCGGATCCACTTGCGTTGCC
ACAACTCCTGGCGTTTTCGATTCAGTGAGCGCTTCCGTGATTACTGTAAAAACAGAGAACACGTACGCTGTGCAAGCGCTCAACGAGATAAGAACATCCA
TAGTGACCCTCCCGCCGTAACGCAGCGCAAGGTAGGCACTTTCGTGAATGGGACGAGCCACAGCGAATAGCACCGGCGTAGCACACACAAACTCGACAGC
ATCCTTGATGCTCAAATGGTTTGCAGTGCCCCAGACCGCTGCATTTGCTGGGTTATTGACAGAGGAAAACAGTACTGGAAGCACAAACTCCACGAAAACA
ACAGGTAGCGATagcaagcagctccacaacAAGAGCCGCGTGAAGCGCCGCACTTCTCCCTCTCCAGCACGAACCGAAGGCGCCCGCGGGGTTGATGCTT
GCACAGAGAAACCCAACTCACGTGATAGATGGCGCACAATAGTACGAGCACCCGTGATGTCCGGATCGTACTCAACGAGCAACGCCTTGGATGGTGAGCC
TGAGGAAGCGGCAGGTTCATcaacgtcttcagcagaagCTACGCCAGCACACTGACGCAATCCCTCCTTGGCGCGAGTCACACTCTCAGGCTGCGAGAGG
TGCAGCACGACACTCACCAATTCCTCGCTGGAGAGTACGCTAGGCTCAAATCCCAGAGTGGCTACAGTTTGCTCAATGCGCTTTGCCGTTACAAGTTGCG
GATCAAACTGAAAGATACCGCGGCACGTGAGCAAGCTCACATTCACGTTCACAACACCAAGCTGAGCTCCCAGATATTTCTCAAttcgtgtgcagcagcc
actgcacgtCATGCCACTGATGTTTAGACGCAGTGTCTCCAAAGACCCGGACACTTCCCCCTTTTGGCctgagctgcttgaggctgtgcgctgcttgtcg
agGGTTGCTCCACGATCGCTACGGAATTgcatcaagcgcttcaagaagctAGGAGTTCTCTCCGGAAACGGCGGTGGTTGAGGCTTCGAGCAGCATCCCG
AGCCACTCAATTTTCGCTTCGGTCTCGGagaacggcagcagcctccCGCACTGGCTGTCGGTGTCTTGGAggagcagcaattggagcCACGGGAAGCCTT
CGAGGGGTTCGATGAACACGCCTTGGGCTGTTTCTTGGAAGCACAACAGCTCTTTAccttgtcttcttccttgaGAGTTTTCGACGAGCAGTCATTCGAG
GCCTTAGGAGCATCCAATGAGCAGCAGCCCGACCCCGCTGAAGTCTTGGTCtcacttgagcagcaaccCGATGTCTTAGGCTCCTTCTCAGAAGCACAGC
AATTGTCCAAAATCTCGGTAGGATCCTTGTCCCCAGCACAGCAGCTGTCTCCTCCTGTCTTTGGATCCTCCTTGgacgaacagcagcttgtcgtCTGCGG
AGTTTCCTCCTCAGCACAGCAGTCATCTAGACACGCGtcttcaccagcacaacAGTCGTCCGAGACTGCTTCCATAGGAGTCTCGTCCccaccacagcag
ccaccaggGATCTTCTCCGTCTCTGGACTCTTGGATGAGCAACAGCTCGAGCCACCGACTTCTCCCTTCGACGCTTCAGTAGCCGCACAGTCTCCAGCTT
CCGCCTTCTTCCCTTGACTGCAGCACGACGTGTCTCCCCCTTGCGTAGCGCTGTCTTCCTCTCCACTGGAGCACGACGGCACAGTTTCGTCCCCGTCGCT
CTTGACGCCTCGCTCTCCGCCGCAGCAGCCGCCAGCACAGACGTCATCCTCCGTCTCGACAGCCACAGGCTCCGCCATCGCCAGATTTGAGCGTCCCTTG
CGTCCCTTTCGACCCATCAGTTCTCGCCTTCACTTCTATCTCTATGTCACGGTGCAAAGGAATACTGTAGACGAGCGTTTCCTCCCCTTCAGAGCTGAAT
TTACCGCAGCAGATCCTGAGTCGTGGGGCACACGCCTTCTTGCTGTTATGTTGCTAGTTTGAAGCAACGCATCAGGAACAAGTTGCTCATACTGAGTAAG
ACGAGTTACCTTTCTGGCTAGACTTTCAGATGCTGTCGTCCGTCCACACAGCCTGTGGGTGGTTCTAAGCAGTGCAGCTAGGAGGATACTCGCAAAGCTG
GGCTTCACTGTATTCCTTGTTACACTCGATCCAGGGCACTCATGGATGCAAGTGCATGTGGAACGGAACATCTACTTTCTTGTGGCCAGTTTTTATTTTC
CACAACAATTCTGCGTGACAAGGTGCCGTGCCCCATGTAAGAGCTAGAGAAGAGCATTCGTTCGTACAGACTTGACATGCACTACACCCGTAATGAACGC
TGCGAACTTTGTTGCACTACAGCAACAGTCAAGATTAAGAAGCGGCTCTGTAAGACTGCGGTCGGGTGTTGGCACTAGTGCTGCTCCGGGGTCTAATATG
AGTTCCACAAGCCAGTCGCCAGCTCATGCACCAACCTAGCGTGGATTTCATGCGTCTTGTCTGTCGTTAATCAGCCAACGCAActcaagaagttgaagtg
gagcgTCAGGGTTATGTTGCACGAAGGTCGCTCTAGCCGGTTAAGACCGGTTAATATGAACCGAACCAtggtgtggtccacacctCAATACTTTTTGCGT
GGTTGGTGAGGAGACGTTCAATCGGGCCAGCAGCTTTATCGACTGCCTCAGTTCTTTTCAGACAGGTAAGCTACGATCACCATGGCTCGCTATAAACTAG
TCGCAATTGTAGGCTAACTGGTAGTAAATCACTCTAAATCAGGTATATTCATCACCATGCCCGCTACCAAGACTGCCGGCAAGCGTCAAAACATCGTCCT
CGCCCGTGGCATCAACGCCATCGCGCGCAACAGCCTCTCGAAGCGCAACGGCCGCTCCaagttcgccaagaaggGCGGCGAGAAGAAGGTCGCTGCCAAG
AAGCCCGCCACTAAGAAGTGGGTGCAGGCGGACTACATCCCCAAGCCGCTGCCGTCGGCCAAGACCAAGCGTAACAGCGTCAAGACCGCTAAGCTGCGCA
AGTCTATCACCCCCGGCACGGTGCTCATCCTGCTGTCTGGCCGTTTCCGTGGAAAGCGTGTGGTGTTCCTGAACCAGCTGGCTTCGGGTTTGCTGCTCGT
GACTGGTAAGAAGTCGCTAC