Description :
From Genome Similarity Track
Location :
Scaffold_128:94263- 99292
Transcript NameFunction/comments
Hyaar_Emoy2810504unnamed protein product
Hyaar_Emoy2810506unnamed protein product
Hyaar_Emoy2810505unnamed protein product
Hyaar_Emoy2810507conserved unknown protein

Sequence
5029 bases(100 bases per row)
GCCCAGGCGGACGCGGCCGATGCCGCCAAGAAGCAGAAGCTTGCGACAGCTGGCGGCAGAAAGTACATCAACAAACAGCGCGTGCTCGTGTTCTCGTCGC
GCGGTATCACGACGCGCTACCGCCACCTGATGGACGATTTCCGGAAACTGCTGCCGCACCACAAGCGCGAGGTCAAGTTGGACGCCAAGGACACGCTGCA
CGTGGTGAACGAGATCGCCGAGATCAAGGGATGCAACACGACCATCTTCATGGAGGCCCGCAAGCGCCAGGACCTCTACATGTGGGTCAGTCGCGTCGGG
ACGGGGCCCAGCGTCAAGTTTCTCGTCCAAAACGGTAGGTTGATAGTTGTTTTCAACCCATATCTGGTCGTTACTAAGTGCTTGGATGGTATGTAGTGCA
CACAATGGACGAGCTGAAGATGACGGGCAATGCCCTCGCTGGTTCTCGACCTTTGCTGACGTTTGACAAGACTTTTGACGAAATGCCGCATCTTCAGGTG
ATCAAGAAACTGTTTACCCAAGTGTGGGGTACGCCAAAGGCACATCCGAAAAGCAAACCGTTCATTGATCGGGTCATGAGCTTTTACTATGCGGACGGCA
AAGTCTGGTGCCGCAACTACCAGCTTGCAGACGACGCGGATACCAAGAAGGCCGAGCTGGCAGCTTTGCACCGCGGCGAGGACCTCGTGCAGCTCATTGA
GATTGGGCCGCGCTTTGTCCTGACTCCCATTCGCATCTTTGACGGCAGCTTTGGCGGCCAGACGCTGTTCCAGAACGAGCACTACGTGTCTCCAAATGAG
AACCGCCGTGATGCCAAGGCCAACAAGCGCGACCGCTACGTGTCTCGCAAGGTTGCGGGTGTCGAGCGCACGGACCGACAACCGGAGCGGGAGATGCCAG
AGGACGAATTTGCGGACGTCTTTGCTGGTGCCAAGCGCTGATGGGTACAAGAAGCAGAGAAATGGCTACAAAACGGCAGAAGACGCATCTGCTCAACAGT
TACGTGATCCTTTCATAGACAGACTTTTGCCCAGCTGTTTTCAAGTTTGAAATAGAGTCTTCTTTTGTCTGATTGGCTATAAATCGTCCCATTTGGTGCA
CCCAGCACAAGGGGACACGGATCCGCGTCGGATGAAGGCGTTCAACACCTGGCGGGGCGCTGACGGAGCTAACAAAGGCGCGAATGACGCAGTCGCAGAG
CTTCAGCAAGTGATCGTGAAGAAAGATCTGATGATTCTCAGTCTGCAGACGCAGCTGGACGCCTATGCCGCACGCTTTGGCGCGCTGCCGAGGGACATTT
TGGACCAATGGGAGCAGTCGAATGCTACCGCCGAGAACCCTAGCCGCGGAGTGCATTGTACCAGGACTGAAGTAACAGCAGCAAGTGACACAAAGAGACT
GCGAGATGGGACACCAAATCGGAAGGTGGACACTAGTGCTACTTCACCAGTATCGGTTAAGGTTCAAGTCGATTATGACCTGGACGAGAGCCGGGAAAAT
GTACCGAAAAGCTGCTCAAGCACAAATGTGGTACTGGACTTTGTGGAAGACTCGCCCATGTTTCGGTGTCAAGTGGAAGGATTTGAAGAGTCGATCACTG
GTCTTCGAGCGTTACTTAAGGAGCTCGTGACGCACTCGAAAGAGTACGCAGCTGCTGGCAAACATTTTGGAGCAAAAGAGACAGCACTGGCAGACGAGTT
GGTCCAGCGCAAACACGCGCGTGCTATTTTTTCTACCAGTTGCTCCGAATTGGGGAGTTTGTCCAACTTGTTTGGTGAGATGCACGACACGCTGGCTCAG
GTGCAGAGCTCTCGGGTGAGCATGTTGCTCGGTGTGGAGTCCTTACTGAGCAGATTGATCCAGCAGTTCCTGGACCAAGATGTACTGAAGGAGGCGGGCG
AGCGGCGGAAAGAGGTGACGAAGCTGGGAGAAGAGTACGAAACACTACTTGGCAAGTTGTTGAGTAAACCCAGGCAGCCAGGACAGGCATATGACGGGAC
AGGGACTCCTACTGGCTGGGGGGATTTGACTGGTCTGCTTGGTCTCGGCAGTCCTGTAGTGCCGGTAGGAAGCCACACTGGAGCTTCTGATGATGGTATT
ACCACGAGAACGCCAGCAACTTCAGCTGCTGTGGTTGGCAATAGCAGCAATGTCGTACACTCAGATGCAGGAAAAACAACTAGCGAGAAACATCAGCGAG
CGCTCGAGCGAGACGTGGTGGTAGCAAGGCGTAAGTTTGAATTAGCTCGCTTCGACTTAGTTCGTTGCCTGAATCGGATTGACTGGATGAAGAAGTTTGT
GTTGGTGGAATGCTTTAATTCCATTATGTATGCGCAGCTGGGACACTTTCATGCGTGTCACGAGCTTGTCAAGTCCGTGGAGCCGACGCTACGTAAACGT
CAAGAAATGATGCAAGTCTCACGCCAAGGTTTCGAGCGTGACGAGCTGATGTGGGCATCACAGCGAGATTTGCTCGACACTCGTTTATCGCAACATGTGG
ACATTGTTAGCTCTAACCTCGAGTCGATTGAACATGTGCCTGATTCATCGGATGTGGCGAGTGATGAGTTACCCATTTCTAGTAAACCATTTATATCGCT
TGACTTGCCCGTTGAGGTGATCTCGATCGACACCTCGACGAGCAGAGAGACTTTGGCCACTTCGCCTGATGGAGCTGCAAAGCAAGGCTACTTGTTCGTT
CGCAACTCGATGTTTCCAGCGAGAAGTTGGAAACGACGTTGGTTTCAGATTCATGCAGGCAAGCTGTTCCAGACTACATGTCGTAGTGGTGGTGGAAAGC
ATTCTACGGAAAGCAGTTTGACCCTCGTGTGTAATTTGTTACTTGCCCGGGTCCGTGAACTGGAGAGTTCAAGCCTACCTTTCTGTTTTGAGGTCATTGA
TGCAAATCGCTCGGCAAAGCATTTACTGCAGGCAGGTAGTGCTCGTGATATGGTCGAGTGGATCGAGGCTGCACGTCGCAGCACTGAGAACGCGCTCGAA
AAGCAAAGTCACCGCCAGGAGGTGCATCCAAAGCAACAGTCCACCATTGATACGTTAACGAAAGCAAGCCCATGCTGTGCGGACTGTGGACAAGAGCCAG
CTGAGTGGGTATCAATTAACATTGGATGTCTCTTGTGCATCGAGTGCTCGGGCATTCACCGCAGTCTTGGTGTGCACGAATCCAAGGTACGATCATTGAC
CCTAGACTCATGGGATATGGCACTACTCACTCTACTCCAAGACGATCTTGGTAATGATGTAGTGAATGCGGTGTGGGAGCACACTATTCCTGATGGCTGG
ACCAAGCCGACGCTTACGGCATCCTGGGTCGAAAAGGCCCAGTTTATCAAGGCTAAGTATCATCTCCATAAGTTTGTCGAGCCAGACAGGACATTGGATG
CACTGGAGGGCAATGATAGCATTGTGAACCGAGATTTGGCCAAGCGGTTCATCACAGGAGCTTCGCGTGGGAATTTGAAAGAGCTGATGTGGTGCTTAGC
ACATGGAGTAGACGTTAATGTACGCGTGGGTGAACAGGATGAAACGGCTCTACACGTGAGCGCTGCTGCTGGCGCTGTAACTTGTTGTAACTATCTTGTG
GTTAATGGTGCGAGTCTGACAATACCTGACAAACGCGGGCGCTCGCCATACGACGCAGCCAATGCTGGAGGGTTTGAAGAAATTAAAGTCGCACTAATGC
AGAAAATGAGTCTCGAGCAGCATCAGGTGTAAAGTGGTACTCAGTAGCAGCAAAAACATACCGTCGACCCTTGTGAGGCTGAACAATTCGCAACAGTCAC
TTGTGTTGGATTAATTTACCGTTCAACGATCTTGTTGGGCAAGACCTCTCGGTGGAGATTCCAACGTGATACAGGACTAGGCTCGGTATGCTGGACCCGC
TTGACGTAACGCGCTATCTCGCTCCAGATTTTTGAAAGCGCACTGGTCTTGCCGGGAATGTCAACGTTTCCTTCGATACGTGCTTTCGTTGGAAGTATTG
TGGTGTTACTTAGCTGATCAGCAAGAGATTACGTTGTTGCACTCTGGAAGATCTCGGCAATGGACCAGGAATCTTTTCGAATGAATCACAAGGGCGCTAC
GCTGTGTACAACTATCTCACTGGTAGCGTAAGAATACAAACGTGGCTGTGTCGATGTTTTGAGCGAGCACGACATTCACGCGTTCAATCGAGTATTCGAG
ACAGGAGTATTTCACCGTCGACCAATCCGTCGTAACTTTGGATCGGTGAAGCTCTAGCCCTCTCGGCAGTGGCCGAATATTCTTTCTCCATTTCTGCGTC
CAACTTGGTGGTGTGCTGCTGCTCCAGTACCTCTTGTGCATGCACATTTCGGATACGACGGCATCACACATCTACTGTCGTCCTCTCCGCGCACTCGGTA
TCCACGAGTTCTTATGGTTCGCCTTTCGTCTGTAGCGGCTAGATCGGTATGAGCCATGACTGTACAGATCTAGCATCTGAAACACGTGCACATAGTTTGA
TTTGACCCAGCTGTGATGTCCGTTGGACGCGGACCCGACCAAGCAACTCTTTGGACTCTATCTCCTCCCGTAAATGTAGTCACTAACAAATAAATAGCGC
GTAATCGCTGTGACCCCGGGAAGATAGGCAAGAAGAATGTATGCACAGACAATCATCAATCCCTGAGCGAGGAATTGCATTGGCGTCGCTGAGAATATGC
AATTTGCGAATGCTAGTTACATACCAGCTCACACCATGTAATATACAAATCGATACATATAGCGCATTGCGCTAGTCATCCGTGTTGGTCAGGTAGAAAA
GTCTTGTTATGGCAGAGTGCTAATACCAATAGATACCGACCAAGATATAATCAGCAGTAAGCATGTAGTTTCAATAACAATGATGTCATGGGGAGCAGCA
AGAGCTGATACAACTACTGTTACCAGCATCGCGAGATGTCCTCATGGTTTTTAATCATGCGCAGTAAATGCTGTGGTCGCAACATGGTATGCATTTTACC
CAAACCACTTGAAGCTGCCAGCAAGAGTA