Description :
From Genome Similarity Track
Location :
contig_5:942619- 943988
Transcript NameFunction/comments
g1725.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
GTACGATGCGTGCGTACCAACTAGAGGGACTCAGCTGGATGGTCAACCTTGCACACCAAGGTATCAACGGTATTCTGGCCGATGAAATGGGGCTCGGAAA
AACACTTCAGACGATTTCAGTGCTGGGCTACTTTTACGAGTTTGAGAACATTTCTGGCCCGCACATTGTCCTGGTGCCCAAGTCTACACTGAGTAACTGG
CTGGCCGAGTTCCAGCGCTGGTGTCCATCTCTGCGTGCCGTGAAATTCCACGGTAACAAAGAGGAGCGCCTGCGATGTGTTCAGGAGGTGTTGTGCCCCG
GTTTGCCCGACGAGAAGCGCAAGTTTGACGTGTGTGTGACTACTTTCGAAATGTGTCTGAAGGAGAAGACAGCGCTATGCAAGTTTGCGTGGAGATTCCT
CATTATTGATGAGGCGCATCGCATCAAGAACGAGAGCTCCCAATTCTCTACGGTCGTCCGTATGCTTGACACGGAGCACCGACTGCTGCTAACGGGCACA
CCTCTTCAGAACAACCTGCACGAGCTGTGGGCATTGCTCAACTTCCTGCTGCCCGATGTGTTCGCATCGTCTCAGGAGTTTGACGATTGGTTCAATCTTG
ATGTGGATGATGATGAAGCGAAGAAGCAGATGATTAGCCAACTGCACAAGATTCTGCGACCATTCATGCTTCGTCGTCTTAAGGCGGATGTAGAGAAGAG
CCTTCCGCCGAAGAAGGAAACGCTGCTGTTTGTGGGCATGTCCGAAATGCAAAAGGCACTGTACAAGTCGCTGTTGCTCCGCGATATGAACACAATTATG
GGCGGCTCAGGTGGTGTGTCCAAGAGTGCGCTACAGAACATTGTGATGCAGTTACGAAAGTGCTGCGGCCACCCGTATCTTTTCGAAGGCCAGGAGGACC
GGTCTCTAGATCCTTTGGGAGAGCACGTGGTGGAAAACTGTGGTAAAATGGTGCTGATGGACAAGCTGCTGAAGAAGCTCAAGCAGCGTGGTTCTCGTGT
GCTCATTTTTACGCAGATGACGCGAGTCTTGGATATTATGGAGGATTTCTGCCGCATGCGCCAGTATAGCTACTGCCGTATCGATGGTCAGACTTCGTAT
GAAGATCGCGAAAGCTCTATCGATGAGTACAACAGACCAAACTCGTCCAAGTTCCTGTTTCTGCTGTCCACCCGCGCTGGTGGCCTAGGTATTAACCTGT
ACACGGCAGACGTTGTGATTCTGTACGATTCGGACTGGAACCCGCAAGCCGACTTGCAAGCTCAAGATCGTGCGCATCGTATCGGTCAGAAGAAGGAGGT
GAATGTGTACCGTTTTGTCACGGCGGATTCGGTTGAGGAAAAAATTATTGAGCGCGCACAGCAAAAGCT