Description :
From Genome Similarity Track
Location :
Scaffold_42:94249- 95469
Transcript NameFunction/comments
Physo_135962reverse transcriptase

Sequence
1220 bases(100 bases per row)
GGCGCAGGAAGAACGAGCTGCCGAGATCAAGACCGAGCACGAGCTGGAACTGCTAAGGCTGAAAGAGAAGCATGCCCAAGCAGAGGCAGAGCACGAGCGG
ACCATGCAGGAGCAGGAGGAGAAGACCCGCCAGCTCCTTGCAGCCCAGGAGCAGCCCAGTCTATATCCTGGCCCCGCCGCTTCGACTGCTGGACGTGTGC
CAATGCCAGCGGACCCACCGGTCCCAGCACCTGTCGTGTCGGCTCGATCGCCGACCGATCCGGTCCTGGCGCAGTTAGCCCAGCTCACGAGCGTGATGCA
GCAGTTAGTCCAGGCCAACCAAGTCAAGCCTGAGGTGGCTGGTATGAGCCGCGGTGCTGGCAAGACCCAAGGTTCGGCCAAGCGTGCTGAGACCAAGTCT
AAGCCTCGTGCATCAAGCGCGACGTCTGGCGCGAAGGGCAAGGCTCGGGCGACCAAGCCCGGCAGGCCCGGAGGCTCGGACGAGGACGACTCTGACTCAG
ATGACTCAAGCTCGAGTGACTCGTCGCAAGATGAGCTCGAAGGACAGTTTGGTGCTGTGGCGCAGCCCAAGGGAACTGATACCAGTTCCGGAACTCGTGT
GGTCGTTCAAGCGATGATTCCCCATGATGCTTTGGAGAAGTTCGACGAGAAGGGACCGCTGGAGGACCGAGTCAACTGGTGGGAGAGGTTCATGTACTAC
GCTACGATGGCCCCCTGGGACGAGAAGACCCGGGTGGTCCACCTACGCGTGAGACTCACTGGTTCCCTCAAGGATTGGTGCGCTCAGCTACCGGATGACG
TTCGCTCGGACTGGAAGAAGTTGTCTCACGTCTTCAAGAAGGAATGGTGCCGTACGCTGAGCTCCAAGGCTGAGCGGTACTACTCGATGGAGATGAAGGA
CTCCGATACACCTCGGATGTTCTTCTACCGTCTGAACCATGCCGCCAAGAAGGCTGGGATCCCGTATCTGAGACCGACCGTCGATCGAGAGGCTCACATC
CGACGTTTTATCAAGGCTTTGACCGACTCAAGGCTGAGGACTACTCTTCAGGGACAGCGTTTCGATACTTTGGATGAATTGGAGAAAATCCTGAAGAGGA
TCGAGGCTCTCCGCCAAGACGAGGGCTATGAGCAGAAGCGGCACCCAGCGCAAGGACTTCAGTTTGGACGTTTCAAACCTCCACAGCGTCGAGCTGAGGG
ACGTGCATTCAAGGCGGAAG