Description :
From Genome Similarity Track
Location :
Scaffold_344:9424- 10517
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_344-abinit-gene-0.45Conserved gene of unknown function

Sequence
1093 bases(100 bases per row)
CATCATCGAGCAAGCCAAGATCCCGTCGTCCAAGATCCGCAAGATCCTCTCGAAGCGCAAGCCGCTCACGCTCAACGAGCTCCACGCGATCATCGTCGGG
TACTACCAGGCCAAGATGTTCCAGGACGTGCAGGACGACAACGTGGGCAAGCTGCGCTCCAACCTGGCGCAGTTCATCATGGAGATGTATGTGCTCCACT
ACGGACTCAAGGACCTCGCGATCAGCCAGCTCGTGTTCCTCGATGCGTCGATCCGAAAGCACGCAAAGGTGCGTGGAGTTAGGGTGGGCGTAAAAGCTCG
TGAGGACTTTGCACTGACAACACTGTTGCATTGCATTACTACTAGGAAAGCGCTCGGGTGCGCACATTTGGGCTGCTCACGGGCTCGCTGGACCCTGAGT
CGCACGCGTGCTCGGTGCAGGGAATCGACTTCTTCCTGTTTGTCGTCGTCGTGATCTTCAATGGTATGGTAGTGCTACCTAGTTCCACAGCAGGTTGCGT
TAGATACCTGAAGGATTCTCGACTAACTCTCAAGGTCTTCTTGTTTGCATGTGTGTCCATAGCTGGTGTATACAAAAAAGGTCGAAAGCAGGCGGTGGCG
ATCGCGCAGAACCTCAAGACGGTCTTCGGCGACGGCATCTTCATGAGTCCCAGAGCAACGACTGTCAAGAGCGACCTCGTGTGCCAGACGATCGATCTGG
TGTTCTCATTCACGCGCAACGATCCCGGAGGACCGCTCGACCAGCTTAAGGACGAGATTCGTCGAGGAATGGGGAGTAGCGGTAGCGGCAGCGGCGGCGT
GGAGATCGACCTCGTGCTCGAGAAGCTCATGAACTACTGGTTCACGATCTACGAACAGCAAATACAGGACATCCACTCCATGTTTGCGCTCGTGGACGCG
AACGGCGATGGCATGCTGGACTTCCGGGAGTTCTGTGAGATCGTGGTTGTTCTAGAACCCGACATCGATCGGCGAGATGCGCTGGTGCTCTACAACCGCG
CGGCGGGAGACGACCACGTGGTCGACAAGGACGAGTTCGTGCAGGTGATGCTCGCGCACCAGCGCGGCGTGATCCTCAAGGAGTTCTACGGCG