Description :
From Genome Similarity Track
Location :
Scaffold_748:9424- 10455
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_748-fgenesh-gene-0.1Fat-free family protein

Sequence
1031 bases(100 bases per row)
CCAAAATCCCCCCTCACACTCTTCTATAATGTTCCGCCGCGCTGCGATCCGCTCCCTCAAGATGCAGGCCTCGGCCGCGACGGCCTCGCGCACGTTCGTG
ACCAAGCCGGCGGCGTCCTCGCAGCGTGCTCGCGCCGCTGGCAACGCCACTGCGCTCTTGGCGGTCGCCACGGTCGGCGCGTTTGCGATCGCGGACGTGG
CGTCGGCGCGCGAAAAGCCGTCCGACGTTGAGCAGATCAAGAAGGAGATTGTCGACATTTTCGACGGCAACAATTACATGGGCCCGACGTTCGTGCGGCT
CGCGTGGCACTCGTCGGGATCGTACAGCAAGAAGGACAACTCGGGCGGCTCCCGCGGCGCCACGATCCGCAATGCGCCCGAGATCAACCACGGCGGCAAC
GCTGGCCTCCACCTCGCGGTCAAGGCCCTGGAAAAGGTCAAGAAGAACCACCCGGAGATCTCGTACGCCGACCTCTACATTCTCGCGGGCAACGTCATGA
TCGAAGAGATGGGCGGCCCGTCGCTGCCCTTCCGCTTTGGCCGTGAAGACGTCCCCAAGGGCGAGGACCAGACGCCCGACGACCGCCTCCCGAACGCCGA
CATGGGCTCCAAGGAGAAGACCACGCAGCACGTGCGCGACGTGTTCTACCGCATGGGCTTCAACGACCGCGAGATTGTCGCGCTGCTGGGCGCCCACGCC
CTGGGCCGTTGCTACCCGGACCGCAGTGGCTACTCAGGCCCATGGACGAACGCCGAGTGGACGTTCTCGAACGAGTACTTCCGCCTGCTCCTCGAGACCA
AGTGGACCGTCAAGAAGTGGAACGGCCCGATGCAGTACGAGGACCCGACCGGCGAGCTCATGATGCTGCCGGCCGATATGGTCATGGTCCAGGACCCCAA
GTTCCGCAAGTACGTCGAGATGTACGCCAAGGACGAGGACCTCTTCTTCAAGGACTTTACGGCTGCATGGACCAAGCTCACGGAGAACGGCGTCAAGTTC
CCCGAGGAGAAGTCGTTCCTGCGCAAGCTCT