Description :
From Genome Similarity Track
Location :
Scaffold_132:94200- 96342
Transcript NameFunction/comments
Phyra_84978DNA-binding protein, putative

Sequence
2142 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGCACACAAGCACCTTCCACAAGAAGTCCGCACTGCCA
CTGCCCCCGACCATCCGCTCCGCGCAACGAAACGCGCAACCGCCCGAACAAGTCGAGAAAACGACATTCACATCAATGAGCAACCCTAGCATGCGCCGCG
ACTGGAGACCGGCCAGCCCCGTGAGCGACCGCGAGTGGGCGCAGGCCGTCCACGCCGTCGTCGAGCGCCGCCTCACGCTTCGCCAGTCCGCACAGGCCTT
CGGGCTGCAGCAGGCCGCGCTGCATCGCCTCGTGCGCCAGCACACGCTGCAACAGCTGCGCCGCCCGGCGTCGACCCGATCACTGCCCGGTTCGCTGCCC
AGCGCGGCGTCCCCGACCAACAGCGACAACAGCCACTTCACGACCCCCGTCCCCAGCACCGGCAACGACCGCTACGTGTTCCCACGCCTGAACCCGCTGG
CGCTGGGCCACGGTAGCCCCAACAACAAAGGCAGCAGCAGCAACGCACCGCTGCCGGGCGTAGCTGCCGCCGTCATGCCGTCGCCGCCCATGTGCGAGCT
CACGCCCGAGCTCAACGACGAGATCGTGGTCGTGCTCCAGGAGCAGTTCATGCAGCAGCAGCAGTACAACGACTACGAGACGACCGACGGACGCTACAAT
CGACTCGAGGGCTACGCGGACGCCGACATCGCCGACGTGGTGCGATCGATCGTGGGCCACAACGGACGCCGCGCACTACCTTCGAACTTTCCGTCCGCCG
GGTGGCTCACCATGTTCAAGCGCGAGAACGACTTCGTTGACGTGGACGATGTGGTCCGATCCCGGGGCAGAACCAGCAGCAGCAGCAACAACAACAACAA
CTTGAAGAACGGCCTGTCGTCCCAGCAACTGCAACAGGAGCGCTACAACCGAAGCTACGAGTTCGAGCAGCAGCAGTTTGAGATCGAGGCGCAGCGCCGC
GGAGACCAGGTGCGCTGGATCGAGAACCGCAACTACCGTCAGCCAGCCGCCCCGCCTCCACCATCGCCACTGCAACGCAGTCCAATACAACGCCATGCCT
CGTATAGCTGGAAGGAGGTCGATGGGACAGAGAGTGCAGGCAGCTCGGTACCGCAGCAGCGTGTGCGCTTCTACCAGCCCCAGCGCCAGTCGAGGGACGA
GAACAACTTCCGTCGAAGTCCCAGTGCCGGAAGCAGCAACAGCAAGACCGTCCATTCGGACAGCGGCAATGCCAGCGACCGCAACTACCGACAGAGCAAC
CTGGTGCCGGCCAAGGTGTGGGAGGCGGCCATGGAGGACGTCGCCATCCACGGCATGAGTCTCCGCAACGCCGCCAAGGCCCACGGAGTGCACTTCGCGG
CACTGCATCGCCGCCTGAAGAAGCGCCAGCAGCACAAACTCAACGTCCCGTGCGAACCCAACTACATCCCGTTCGAAGATGAGGCCGGAGTTGTCCGTGT
GATTCACGCGCGTGCGGAAATGGGCGTCTTGCTGACGTTCACGGAGCTGGTGGACCTGCTCAAGCGAACGGCGCTCAAGCACCGCTCGGAGTTGCCGGAA
GAGATCGCGATTGCACTCGTGCGCAGGTTCCAGTCTCGCGTGGAGCAATCGGTTCGCCACTTGATCATCGACTGGCCAAGTGTGTCGAGTAATGTGCTGT
ATCAACTGCGCGAGGGTGACGGCAAGGACGGAATGACTGCTGAAGCTCCTACTCCTGCCAGTATTGGCAAGACCAACGTGCCATCCGTCGTGAGCGGAAG
CAGCGGATCGCTGTCGTCCTCGGGGTCGTCTTCGTCCCTCTC