Description :
From Genome Similarity Track
Location :
Scaffold_3158:942- 2144
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3158-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1202 bases(100 bases per row)
GTCGTGAAGCCGTAGAGCTCCGTGTCGAGCGTCGCATATAGCATCAGCTTCAGCTTTCGGCGCGATTCGTACATCGGAAGCGTCAACCGGTTGAAACATG
CGTGGCTCGATACGTATTCGCTCTTGGAGAGCTCCACGCCGTGGAGTGTGAACGGACTGAGTTGGCCATCGTAGCTCGTCAGCGCACTGAAGCCAGCGGT
GGGAATCCGGAAGGAGCCGGTCACAAAGTGCAGCAGTCGGCGACGATACTCGTCCGGCATTTCTCTCACGATCTCCCAGAACCACTTGACCAAGCAGTTC
GCTCGATGTCGCGTGATGCTGCCTCCATGAGTGACGAAGTAGGTGTCGGGATGTTCAGTGTGCCACTGATCTTGGTGTGTTTCTGCCAGTCGTTCACGTC
GATGATGCTGGAGCCACAGAGTACGTAGTCGAGTTCCTCTGGGTCGAAGAGCATGAGAAGCCCCTGTGAGATGACCTCATACGGTCCCTTCAAAAAAGCG
TAGAGCTGGCTGGAGACGCTCTCGAAGAGCGTATACTTGAGCTTGCGATCGGGGAATTCGTTCTTGTTTGCATCTGTCACGAGAATGTTGCGGCCGTTAG
GCATCAAGTCGACAGTCACGAAATCATCGCCTTGCTTCACGGTTACTCTGAAGTTCAGTCCGAGTGTCTCGACTTCGTTGTTGTCCAGCAGCCACGCCAG
ATCCTTGGATGTCTCTGGGTCAAAGTACACCAGGTCGCTGAAGGATACTGGTAGACCTAGAATGACCTTTAGCAGCGGCAGCGCCAAGTGGAAGCCCAAC
ACCTGGCCTTCCAACAGCGCACGGCCTATCAATCTTCCCGTGGCAAAGTCGTACAGCAGGTGGTCGTCGCCGATGTCCTTCGCTGAGGTGGTGTTTAGAT
AGTACGTCTGCTCAGACATGTTGACGCACTTGAACACACCGACGGCTGGCTCGCAGAGCTGCTGTGATAGCAGCTCGAACCACTCGCGCTTCAAGCCACC
GGTGTCAATCCCCGTCTCGTCATGGAACGTCACACGCAGTGACGATCGGATGCTGGAGCGTGAAATCACACCGAGGAACTGCATTGAGTCGTCAAGCAAA
CTTAGTCGAACGACATGGGCCGAGATAATCTGCGAGTTGTCGACGAGACCGGAGGGTCTTGGCAACGAAGTGGGCGTACTTTGTGGGGAAGTCCTGGGAA
GC