Description :
From Genome Similarity Track
Location :
Scaffold_41:94195- 106101
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14708hypothetical protein
Phypa_INRA-310PPTG_14709hypothetical protein
Phypa_INRA-310PPTG_14710hypothetical protein
Phypa_INRA-310PPTG_14711chromodomain-helicase-DNA-binding protein 1

Sequence
11906 bases(100 bases per row)
TCCGTATCTGATCCTGTGCCCCCAGCCGGTGGCGTGTCGTCACCCCGTCCGTCACGTGCTCCTCCGCCTGACGACGCGCTGTTACCTCGCCCGACTCCCT
GCGAGTCACTTCTCGCGTTCCTTCCAGCACCAAGACCGCCAGTTCTCCCTCTGGTCGGCTCGCCTCAGTCCAGGCTGCCGAAGGTGAAGCCGCCCATATC
CAAGTTCATCGGTGTGCGTCCTGTCGACGGCCGGATCCCGCTCGTCTCCAGCGTCACCACGACACCGTCACCCGTGTCCACAGTCGTCGCCGCTCCCGGC
TGCCGTTGTCTCTTAGCTGACGCCTGCACGGCGCTCGCAGGCCGCTCCCGTGACGCGGCGCGTCGTTGAGCACGCTCACCTCGCTCCGTAGCCGCTGCCA
TCGTCAGAATTCTACAATCCAAATACAGCCACCTCTGTTAGCCCTCACCCTTTCAGACCGACTCCTTACTTCGCTCTCCGGGGTCGCAACTTCAACTACT
ACCTCCTGTCCTCGGTGGCACTAGCTCACTGACTCGCTTCCGCCACCGCATTGCATCCACAACACTCACTCGCCACCGAATTAACTGGTGTCGTCCACGC
CAGTGTCGACCGTTAAGTCGATCACTTCAACTTGCCGCCCCTGCCAGTTCGTCGAGGCCGCATCGTAGGTCATCCTACTACACTTTCATATATTTACCGA
TAACTTTGAAGGCTCACCTCGGCAGAAAGCGGTAAGCACACCATTGAAAAGCCCCCGAGTTAGCGCACCTGAGCATATTTTTTGTTGCTGCACTAGCAAC
AGGTACGGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTGCTGAACGATGACATCGGACAACTAGAACGCGACATTGATGATATTAAGGACAAGA
TCGAGACACTGAAGAATAAAAGAGGGTCCGATTGGTACCCACTGTTGACAAAATGTTCAAATTAGCTCCAACAATTGTCAAAATGATGCACTTCAACTTA
CAACAAATTCCACCAATCGTTGAGCAGAAACGAAAACACGAGGTTTGATTCAGTTCGGGAACGCGATGCCATGGTTTGTGCACCACCACGTGCCGTAGCC
CAAGGAGACGTCGCCCGTAGTGGACAGACTGCGACTGCAGCTCAACCGTACGGTGCGCAGAACTGTGACGGAGACCGTGGACGCTGTTTGGGTGGCCTTC
TCGGATGAACTGGCACAGCTAACGTTTAACGGTCCGCCCACCGCACCTGCTATGGACGACTACGAACTGTTTTACGACTGCTGCAGCCGACTGACCAAGT
TCATCGAGAAGAATATGGACACGACACCCGGGTTTTTAGAGCAGATGGACCGCCTCATCTTCGCATGCCACTATGGCGCCCCGGGGTCGGCGGTGCGCTT
CGCCATGACGAAAGATCTGCGCATCCGTAGAGGCAAGGCGAACAACGGAAAAGAGCATGTTAGCATCAAGACGGATCATTTAATAGCAGGTGAGAGTGAG
CAACCGGTGATTTCACCGCCGAGTGGTACACGTGGAATGGAGGCTTCCAACGAGGAGTCCGAGGCGACTACTACAGTTGGAACGGAATCGAGGCAGTGGA
CGAGGAAAAGACTGTCGACGACGAGCCATTCACCACCAAGACTGCCTCCGTCGAAAAGAGCGAAACGATCGTCGGCTTCGGATTTGGGACGGGGTAAAGA
TGGAAACCACGAGGAAATGGCGACGAAGAAAAGTGACAAAGAGAAGAAGAGAACGAGCACCCGAACTTCGCCAATGCAACAGAATGTTGGTCGACGCACG
TCGCGACGAATGACTTGTGTTCATCGACAGGTGAATGGTGTTGAAGATGATCAGAGAAATGATCGGAAGACAACGAAATCGCGGAGTGGTCGTTGTGTTC
GTCGACCGGTGAACGGTGTTGGGGATGATCAGGGGAATGACCGGGAGACAACGAAGTCGGGGCGTGATCGTTCTGCTAGTTCAAAGCGTCAAGAATCTCT
CCAAGCTGAAACTGGGAGAAAGGTACGACGAAGCTTGAGACGCTTATCGAAATGTACCAATGATTCGCGTAAATCCACCGAGTCCAATGAAGACTACCAG
ACACGATCAAAAGCAAAAGATGAAGCGAAGGATCAATCTGAAAAAACTGACACGACCGGGTCGGAGCAAGACACTAATGTGATCGAGGAAGATGACCCGG
ATACCGACGCTGAACAAGTGGTGCCTCCTGAAAGGGAGATAACGTCAAACGGGAAGCAGGTTCATCCAACTATTGTATTGGAATCCCCCTCACAGTGTGC
TCTTGAAGTGATGACAAGGCGAATGACGTTGCTGGCGTTGATGAGGGGCCTGAAAGCAGGACCGAAGCGACACACATTGCTGGCTTGGAGCAAGAGAATA
ACGTGACCGGAGCGGAGACTTGTGCGGGTTTCGAAGAAGAGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCACAAGTAAGTGGTGAATTGAGGAATATCGACAGTGCTGAGAACAAC
AAACCTGAGCTCACAAGTGCAGAAGTATCAACGACGCAAAACACTGTAGCTGTGCACGGTGAAGACGCGAGATGCAACACCGATGGTAAAAGTGACGCGC
TGACAGAATTTCACCAAGGTGTGGTGACGGATACGCCTTTAGACACCGCCGCTGCATCTGATCAGGAGAAAGACGCTTCTTCAGTAGAAGACGTTGAGCA
ACCAGTTCCAGGCCTTTGCGACGCAGGAATGCGGACTCCACTGCAGGTTAAGCACTACAAATCGTGCTTACGAATGTCAATTCAACTGGTGGATTCATTC
CACTGCAAGCCACCTCCCGGTAAACGCTGCGTCAGGAATTGCGAGAAAAATATTTCGCGAAAATGTAGTGAAGGGATTCCTTGCCGTGATCACCTTTGTC
GTAATTGGCATAACACACAAGCGCACAGGGAACTATGCACGAACCCACTGTGTGAATTTAAGACTCGAATCCAACTTCGCGAGACTATGAACAAATCTGC
AAACCTGGATGTAGAACTGCAGCTACTGAAGTCGCAATGGGAAGAGAAGAGCCCGGACTTGGCCGCAACCACGACTAACAGATCAAAGGAGCACTATACG
CTCGACCAATTAACGGTGCTGAACGATGACATCGGACAACTAGAACGCGACATTGATGATATTAAGGACAAGATCGAGACACTGAAGAATAAAAGAGGGT
TACTTACGGCTATCCTCAGTGCAATCGGGATAGAACCTCAGAACGATATAGCTGATGGCTTCCCCGACTTCGAGACGCACTACATGTGATCATGAGCGCA
GTGTTAAGCTTGTTCCGTTGGTTAAGTTGTATGTTCTTGCTGAGATTTGACAAACTAACTTTTTCGTGAATAATAGTAAATGGTTGCTTCAACACCCACG
TCCCGAAGATTGCGTGCCAGCAAACGCTCAACAGCATACCAATTGAAATTCGGAGTTCCATAGCCAATACGGGGTAGATGAACTGTGGCCCCCAACTCGA
GTGCACGATACGCTAAAGCCTGCAGCGCAGTCTCCAGTGCATTGAGCCGAAAGGTCGACGACTTGCCCTGGCGAATAACTTGTATCACGCCGGGTCCGTT
TCCCACGCGCTGCTTCTTCTTCCCAACGAATCCCTGTACAACGAGTAAGCACACATATCCGTCGTTTGGCGCGTTGTTGTCAGTCTCTGGTAGTCGAATC
AAATGGGCGCTGCCAAGCTTGAGGTCACTGTTGCGTCCAGCCGCTTCATACTGCTTTTGGATAGCAGATGAGAGCGCCGACAGGCTGCGAAAGAATCCAC
GCGAACACCAAACACCGCTGTTGTCAACGCAATGAACAACAATGTAGGGGCTTGAACGTAAACTCGTAAGAGGAGGATGGCTGGCATCGCCGGACTGGTA
GTACAGCCGCCCCGGGCTTCTGGAGGAGTCGTAGCCGTCAGAACTACGCGGTGATGATGGCACACAGCCGTCTGCTGGATCGATAGCTGCCGATGTGTAC
TTGTTAGCTTTCCACTGAGCAAGTTTCCTTTCCAGCGCTTTTTGACGCCGTTCCTCTCGTTTTCGAGCTTGCTCCGCTTCATTCTCAATTGCCCTCTCCT
CATCTTCCTCGTCTTCCTCTTCGTCTTCTTGTTCATATCGCTTACGTGCTGTCTTTGTCTGCCGCTTTGTACTTGTTGCGGCTTCTTTGCATAATTTCTC
GAGCAACTCTGCATCTTGTGCCTTGTTATTCACGGTCTTTTTGTAGTCTTCTCCTTCAAAGTAGTACATGTTTTCCTCTTGAAAATCTCCGCCTGACTCT
AGCAGTTTGTCGCTCATCAAAGTTGATCCTGTCTTATCGTCGGACCCCCCAATAATCTTTTCAATTGGATGGAGTGATTTCCGGGTAAGAATATGTTCAA
TGTATTCCTCCTCCAGAGGCTTCATCAGTGAGTCTTCATCCTCCCCGGCAGCCTCTTGCATCAGGCGGTGTAATCCAAACTGGATCATATCCAACAAACT
CTTGTTACTATCGTCATCAGTTTCGTCGTCCTCGTCTTCACTTCGGCGCGCAAGGTTACGAATGCGATCGGCCATGCGCATTTTCTTCAGAGTGCGCCGG
TATATGCTCTCTTCGACTGTGTTTGCGCACAAAAATTTGATCACATGGATAGGTTTGGTTTGACCGAGTCGATACGCACGCGCTATCGCCTGGAGATCCG
TTTGCGGGTTGTAATCCGAGTCTGCAAAAATGACCGTGTCTGCGCTCTGTAAATTCAGTCCCAAACCTCCAGCTCGTGTGGAGATCAGAAAGACGAAAGT
CTCTGGGTCCTTCTTGAAGCGTTCGATGCACTGCCAACGCTCTTTGCCACGTACAGACCCGTCGATCCGCTCGTATGCGAAGCTCTCAAGTGTGAGAAAA
TCCTGAATAATATCCAGGAAAGGTGGGGACTGGCTAAACAACAGCACCCGGTGACCCTTTCGTTTCAATCGCGGCAAAATTTGATGCAGGACAAAGAGCT
TGCCAC