Description :
From Genome Similarity Track
Location :
Scaffold_1:941825- 944762
Transcript NameFunction/comments
g287.t1hypothetical protein
g288.t1RAW26116.1 hypothetical protein PC110_g17476 [Phytophthora cactorum

Sequence
2937 bases(100 bases per row)
GGGGCAGGAAGGAAATTCTGATGTGGCGATGGGAGCGACGACGATTATGGTGCCGTACCGTACTTCGAAGTCAGCAGACGTCGCGAGAAAGGGCAACGTT
GAAGTTGGCAGCCAATGACGTGACGGTACACTACCGATATACCGGTGAATCATCAGCTCGAAGGTGGCAGCTGAAGCACGAAATGGATCTGTGGATGACG
AGTTAGCATTCGTCCACGGTCTCCGAGTCTGACTGGCTGAAGCTGCCCCGACTGCCAGCCACCGGGTTTGCTTCGCTTCTTGCTCGCTTGAATCAAAGTT
CGAGCTCGAAAAGGCCCGCAAATCGCGGACCCGGTGCGAGGCCAACGCTGTTCATCACCCTAGTGCCTTGATGGCGGTGCCTTTATATCGCCTCCTTCGT
CTCACGCGCCGTGCCACACGCACACGCATCTTCCACCTGCGGCGGAGAATTTGGAGCGAGAAGACCGCTTTCGCGTGGCAGAGGCCGAACACCACGTTTT
GATGTGATGAACACTCTCGCTGCTCGTGTTGACGATGCCAAGAAGCAAATGAGCGGCCAAGCTGTAGCTGTAGGCACACCGAAGATTAGCATCGCATAGG
ACAGAGGACGGTTGAGACATGGACTTTATCTGTGTAAATAAGTGGCTGAGCTTTTTTTTTTTTTTTTTATACTGTGCCCACGGCAGGGGACTCCCGCTCG
GTGACGGACGCCCTTGGCCCCTCGCACTGCGCGAGGAAGCTGTACATGAGCTGCGAGACAACGAGGAACTTCCGGCACTTACTGCTGCCGCTGCGGTACG
ACATGTCCTTGGACGCCTTGAGCATCTGGTTCATGAAGCGCTCGAGGCGGTGTTTCCGGATGCGAGCCAACAACTGACGCCAACCCGCCGCGAGTGGGCC
GCGGTTCGGCACACGCGACGGGAAGCCCGCGGCCGACTCGGTGGTGCCCACGCGACTGCAGTACGCGCAGAAGCGGAAGTGGTCGTGGTCATTCACCACG
TCCGATATGCTCTTGACCATGGCGCGGAAGTCCGAGTACCGGTGCTCGACCTGGTAGTCGGGCGTCTGGCTCTGATTCTCGAGCCGCAGGCGACGTCGGC
GCTGGTCCAGCGTCTCCACCGTGGGAAGACCCTTTTGCGTCGTGCGGAGGAACACGTCGACCACGTATATCGTGGCACTGTCGGTCTCGTAGGTGCTGCT
GATCTCAACACGGTAGATCTCGTTGAGCGACATGGCCGACTTGGCCGTCGTGGACAGCTGCGAGAGGCGGCGGCTCGGGCTTATGCTCAGGCGCAGCTCT
GTGTTCACGACGGTGTCACGCTTTGAAGAAATGCGCAGGCTCATCATAACGACGGTGTAGCTTGTGCTGTCCACGGCGAGTTTGATTGTGGGCGGATGCG
TGTCAAAAATCGTTCGTGCAGATGCGTGCTTGAAGCTGCCACATCTAGACGGCCTGTAAGATTGACCTATGCTTTGGATGCATGCTCGGTAAGCGTAGCT
GCTCTTGTAAATAGGGCCCGTCAAGCGGCCTTGTGTGCGCCACATGATGGATGACGCCTTGTCGCAGGTCGGAAAGGAGACGGGCACGATTACGATGGTG
CGCCCTTTCGCTCTGATCTTGCTTGACGCGCATGGCAACTTGTCAGGGGTAACTTTTGCGTTCTTGGCGGGCGGCGTCGGCGATGGAAGGCCGGTAGGAT
GACGAGGTTGTCGCTCGGAACGCGCCTCCACTTCGCCCGCCCGACAGCGCAGGAACGCCGCATCTGGAGACTGTCCGCGCTTCCAACCCAGCCCAGCGAC
GTGCTTCAAAGCCGCCTTTGGTTTCCCAGTGGAGTCATCACCCGGGGGCACTTGCGTCTGGCGTCGTGATTGCGGCTTGACTGGACAAGGGCTTGCACGA
CAGGAGCCACGCGATGTTTTTTGGCTCGCTGTTGTCGATGTGATCGGCTGACAGGAGCAGGCTACGCTGTAACACAAGAAACAGGGCGGTAATATCGCTG
TATTGATCGTCCTCGTGGCTCATGGCAAGCAGCAAAAATTGGTATCCTAGCAGCAACTCGACGCAGTGGAGCTCACGGCGGTTCGCACGTGTGGGTCTCC
TAGGAAGTCGTTCAGAAGCCCTGACACCGTCACGTAGCGCGCACACTGGACGGCGCTGTATCGGTACGATACATCCTTGGCTGCTGCCACCAACTCGTTG
ACGAATCGCTCCAGTCCGCGCTTCCTCGAGTGCACGAGCAGTTGTCGCCAGCCTGTGTAGGTCGCGACGGGGCCTTGGTTCGGGTAGCGCGAAGGGAAGT
CGCCGACTGTGACCAGCCACAACACACGACTGCAGTACGCGCACCATTGCGGGTGCTGGTCGCTCTCGCTCGGAGCGTTCACCACGTCGACGATGCGCTG
TCGCAGCAGCCGGAACGCCGAGTAGCGGTGCTCCACCTGGTACTCGGCGCGCTCGCTGGGCTTGTCGCGTTTGGGGCGCCATGTGAGCTTGAAATTGTGT
TGCGTCGGCGTCTTGGGCAGGCCCTTTTGCACGTCCTGCACGAAAACGTCCAGCACGTAGACAGTCACGATGCGCTCATGCTCCTCGCAGCTGTAGGCAG
CGCGGATGGCCACGTGGCTGATCTGGTTGAGGGTGACGGCGAACTTGGCGCTGCTGGACATCTGTGAGAGGTGGCGCCCCAAGGCCGCGTCCAGGCTGCG
GCGCTCGTCCTCCTGCTCGCTGCTGCTTCCGCTCATGGCCTGGCTTCAGAAATGGAAATGAGTGGAATGAGAATCGTGGTTGAAGTCTGCGAGATATCGG
TATACCATTTCGTTACCGGTATGGTCCGACTTTCGTCGGGTTTGACAGAAGCGCGCAATCATGCGACCGACTCAGGGGTAATCAAATTGCGCTTATCACG
ATGTCCGCAAGGTCACGATGACCACCGCCGCCACCAC