Description :
From Genome Similarity Track
Location :
Scaffold_8:94178- 96105
Transcript NameFunction/comments
Sapdi_VS20SDRG_03280hypothetical protein

Sequence
1927 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCTGCGGCGGCGCGGGCGACAAGTGCCCGAAGAAGGG
CGATGTGGCCGTTGCCGACTGCATCAAGACGCTGAAGAGCTACGCGGACGGTGCTAAGTGCGTGGCGCCGGTGGACGCCACTTGCCAGACGATCAAGACG
GGCGCGAAGGGCTGCGTCTTTGGCTCGTCGGAGCCGGCTGGCCCCACGCAGGCTCCGGCGGGTCCTACCCAGGCTCCGGCTGGCCCCACCCAGGCACCCG
CTGGTCCCACGCAGGCGCCCACGAGCGGCCAGTGCGCTGAGAACCACAGCCAGTGCAACGGCCAGAACTGGCCGTTCGGCGTGTGCTGCAAGGACCCGAA
CTTTGAGTGCAACAAGAAGAACGACTACCTCTCGCTCTGCGAGCCCAAGAAGAAGGCCATGGACGCCGAAGCCAGCCCCGTGGCTGTCTGGCAGAAGTGC
GGTGGCAACGGCCACAACGGTGAAACCACGTGCACGGCGGGCAACAGCTGCGTGAAGATCAACGACTGGTACTCGCAGTGCCAGCCCAACGCGACGCCGG
CCAACAAGCTCAACACGTGGTCGCAGTGCGCTGGCTCGGCCAACAACTTCCAGGCCGGCGGCAAGTCGTGCCGTGACGAAGATGCCTGCGTCAAGTACTC
GGATGCGTACTCGCAGTGCGTCCCCAAGACGCAGCAGAAGGATGCCGCCGCCGAGATGGCCTGCACCAACGTGAGTGTCGAGGGCGATGCCACGTACTGC
GTTGAAGGCGCCGTCTGCGGCGGTGCGGGCGACAAGTGCCCCAAGAAGGGCGACGTGGCCGTCGCCGACTGCATCAAGACGCTCACGAGCTACGTCGATG
GTGCCAAGTGCGTCGCGCCCTCGGATG