Description :
From Genome Similarity Track
Location :
contig_237:9414- 10610
Transcript NameFunction/comments
g12228.t1hypothetical protein PHYSODRAFT_478459

Sequence
1196 bases(100 bases per row)
CTTGACAACACACCCTTCCAACGATGTACGCAGTGCCAATAGGTCTGTAGATGTTAGTGTGGTGAAGTGCTCTCCGAAATGTGAGCGGGAAAGAGTGAAG
TGGCCACAGTTCCGGAACAGTGACAGAAGAACGGGTCCGATTGATAGATCCGAACTAAGAAGACGATACGGCCAAGAAAGGTGACAGAAAGTGCGAGATG
AGGGATGGGTCCCGCCAGGGACGCCAGATCCGACAGATAGCCCAGACGAGCACCCATGTCCAGATCAAGATCGGAATCTGTGGAGTGTAGATTGGGGAAG
TGACGGCGCACCTGGATCAAGCGTCACCGAGATGGCAGATGCCTTGGAAACCGAGCCGACCAGATCGGGATCGGGCCCCACAGTAAGTTTTGCCCAGATC
ACGATCTGGCTCGGCAATGAGGCAGGGGCGGATCCCGGATCTTGGATCTTGGATCCGGCCGACTGCGAAGCATGGGATGGTGAGGAGCCGCAATCAGGCG
ATTACATCAAGGTAGCCGGTGCAGAAGACGGCGGGGGGATAGTGAGATGGCAGAAAAGACGCATAGTCAGTCGTACACCGTAGATGAGTGGATGCAGGAT
CGGACAAAGTATGGGATAGGACTTAACCATAAATCAGAATCGAATTTGTCCTGAACTACAAGAGTGCTTCGCCTCCGCCAAGAAACGGGAGCTACATTGG
CCCTACAAGGTGTTGGCAAGACAAGGAGTAGCTGATCTAGTGGTTGTGTAAGTCTGGGTAATATATTGGCCAGACCTTACCTACTCTAGTGATCTATTAT
CAAGTGCAGATCCCAGATCCGACGGAGTTATTACTTGGCCCGAAGATCTCTCGATTTCTCAAAACCCCAGAGCCCCCGCTATAGGAAGCGGCAAGTAACG
CAAAGGAAGGAGATATCCACACCCCAAAGGCAACCCCCGGCCCCGGATCAAGTCCAGGCCGCCAGATCGGAGCTTGATTGAATCGCTCCGGATCTGGATC
CATAACCGGCAGCAGAGCGAAGACTTCCGCGCTGCTCCACCCCATCCCCGCGTCCCGCCAGGACGACATAGCCACATCTCTTCGGAGCGCCGAGAGAGCA
GATCCAGCCACCAACGGGTACACAAGGTGAGAAGTTCAGCAGATCACGGATCATCGGGGGACCCCCTCCGTTAGTTGGTGTCTGCGCGCTGTTGGG