Description :
From Genome Similarity Track
Location :
Scaffold_5:941314- 944202
Sequence
2888 bases(100 bases per row)
ACTTCTTGAGTTTTAGGCTAAGACGTGCACTGGCCAGCCGCTCCAGCACATTCGCCACTTCGACTACGTGTTGCTCCACGCCGCCCTTCGTAAATACCAC
GATGTCGTCTAAGTATACCAAGCACTTCATCCACGTCAGGCCTCGCAGTACACCATTCATTAGTCGCTGGAAGGTTGCCGGTGCATGGGCTTCATACTCA
GCTCCAGTAACGAGGTGTCGAATCTCGAAAGAGTGTGACCGTGCTGCTACCACTTGGATTGGGCCAACCCACTGCCCAAGTAATTTGTTGTTGGGTAGTC
GCTGGTCGATTCGCGACCAGAGAACGAAGTCTCCGACGTCGAAATTTGCTGCGACGCCGTACTTGGCTGCCATCGCTTGTAGACGTCGACGTTCCTTAAC
GTCCACAACTTCCTTATGAAGATCGTCTACGAAGTCGCTCCAAATGCTCTTCCACTGCATCCGGCGTGATCTCCAGCAATTCCTCGTCGCTGCCAGGTCC
ACGTACGACGACATCCAGAGCAGAAGGTGGAGTAAGCCCAGTAAACAACTCCATAGGCGAGTAACCTCCAAGTGATCTGACTGCAGTGTGATTCAGATTG
GCTTGGACAATGACAAGTAGGTATGACCACTCGTGGAAATCCAGCTTGTACTCCAGAAGTAGCGCACGGAAAACCTGAAGGATGTCCTTATTCAAGCGGT
CAATGGTCCCATTAATCCACGGACTATATAGTGGGGAGAACTTGCGCTCGATCTTCAACCGCGCACACAGGTGGTCCACCAATTCGTTACGAAAGTGCGA
GCCCTGGTCAGATAGCAGAATCTCGGGCAGCCGTACCGCTTGTACCATGCCAGGAGACCTTCTGCTGCAGTGTACGCTGTAGGTGTGCTGCACGGAAACA
ACTCACAATAGTGCGTGCGGGAGTTCTTTAGCACCAGAAGATAGCAACTACCGTCAAATCCGTCAACTAAATTGGTGAAATCCCAGTGAAGTCCTTCATT
GCGTCGGCTAGCGGTAAAAGTAGGTCCATACGGGCGCTGAATCAATCTTGATCCCTTGATATGTTTGTACAACAGACATTAGCGCACAAACTTGGCCACT
TTCTCGTGCAGCTTTAATATGTAGAATCGTTCAGCAAGAGCAGTCTTCATTGGCACTACTCCTCGATGACCATGGGCACCGCAGTGTGCCACGACGAACA
GGCGGGCAAGCAGGTCAGTGGCAGTAGTTGGGATGCAGGGGCGACCACTAGTACACACCACACAATCCACCTCCTCAAGCTCGACCGTTAGCCGTCCACG
CTCATTGCGAGCAAGCTCTTGGGCATCTCCAATGTCCTCAACGGAAGGAAAAACAAAACCCGCGTCCTCGAGGGGGCGAAGTGGCGAGAGATTCTCAACA
GGACGAGCTGTTCCACGTCGAATGCGAACAACGGCGGCACATACGGGTTCGGGAAAGCGCCAACGAGACACGATGTCAGCCCAGACATTCGGTTCGCCTG
GAATGTGCTCGATAGAGTAGATCAGACCGCAGAGGCGCATGGCCCAACGCTGCAGTCGGTCTCGAATGTGACGCTTGAGCTCCTCACGTGGTGCGGATTA
GGTTGGGATGGTCACAAAAAAGCTTGAATCTTTTGCGGCGGAGAAGGATATAGTCGAGTTCCGAGCAAGCTTGGATAATTGGGTAAGCCTCCTTTTCCAC
TATCGACCATCCACGTTGGTGATCCTTGAAAGATCCACCCTTGCACACTACCAGTTGGTGGGCTTGCTTGTCGACCGGGAGCGAGCTGTCCCAAGTCTGT
ACCATCGTCACCACGATACTGTACCCATCCAAGCTCGCATCAGTGAAGACGCAGATCTCATCCTCGTCACTTGGAGACACACGCAGAGCTGCAGCACTGA
TGAGCTGGAGGACGCTATGGTATGTCGCTTCCTCGTCACTGGTCCACGCCAGCGTTAAGAGCGTTTCGGCGGCGACGACCAATGCGTTTGCGTTCCGCAT
CCAGCTTCACCTGCAACGGAGCCACCATACGCGCATAGTCCACCAGCGAGCCATGCAACCTGTTCGACGCGCACACAAAATACTGGAGCTCGGCCACCGC
GCTAGGAAGTGGTAGATTTGAAAGGGCACGCACTATTTCGGGGTCGTGACGGACTCCCTCGCCAGAAATGAGGCGTCCACACCAAATGATCGAGGTCTTA
TAGAGGGAGGTCTTCGGGAGGTTGAGTTTCAGGTTATGCTCAACAAGCAGCTCGAAGAATCGCAGCAAGACCTTGAGAAACTCGTCCATCGTATCCGCAA
ATAGTATAACATCGTCAATCCAAACCATGCCATTGCGGGGAATGAGCTCAGCAAGAGCAGTCTGCATCGTTCCTTGAAAATGCAGTGCAGAGTCGACGGT
ACCCTGGACAACTCGAGTGGGAGTTGAAACACCGTCGTCCGTCATGAAAGACGTGATCGCCTGGATATCCTCGTCCAAAGGCAGCTGCCAAAAGCCATCC
TTCATGTCGAACGACGCAAACGCCTCCTTGCGGGTGATACTGTCCAGTACCTTGTTCCCATTCGGCATAGTACCTGCAATCGGGACTGTTCTGGCGTTTA
CCGGCCGATAATCGATAGTCAACCTGTACTTGTCCTTAGTACCAGGCTTGCGTACAGGAACCGCCGCTGAGGCCCAGCGGGAGCTGTTGTTCCTGCGAAC
TTGACCACGATCCAGTAGTTGCTGCACCGTTTCGCGAAGGAACTGACTGTGGAGAGGCGCGTACTTCCTCTGCTTACACCGGAAGGGTGTCGCTCCCTCC
TGAATCGTCACGCGGATCGGTTCCACCGCCGCCGGCGGCCCGAATCCAACCTCGTCCGCCCATACATCACCTTCGGAGCCCACTTGAC