Description :
From Genome Similarity Track
Location :
Scaffold_72:94123- 98391
Sequence
4268 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTGTGGACTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCC
TCCCCCTCCTGACCCACACCCTTCCTGTGGGTTCTTCTTCATTCTCCCGTCGATATGACCAACTCACATCCATGGATCCCCTCCCTACTCTTCTTCGTGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGGTCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCCGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTTGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACCTCGTCGAAGTCGACGCGGTCGGATGCGTCTACCGAAAGACGGATTTGCGGCCGA
TCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTGTCAGCCTCACCGCATGTTCTCCAA
TCTTCTCGCTCACCCGGAACGGCCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCAC
TTGGATTTGATGTGGACGGGTGTCTTCGTTGTGTCGATCTGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAG
TATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCTAGGGTGGATTTGGGATCCCACC
CATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATC
CAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGT
CGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAA
CACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTC
TGTGTTTCCTTTGAGCGACTTGGGCAACGAAGGGATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCCCCTTCG
ATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCC
GTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAATCTCAT
CAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAACGCTGTAGGAT
TTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTTTGTGCTTTGAGGATCCGCTCGA
TGCGAACTCTCTTCACGAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGAGACAGCCATCACCTGGACTGTCCTTTTCCC
GGATCCAAAACAGGTACCACTTCGTCAAGTCGGTTCAACGTAACGAGATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAA
TGTACCTCTCTTAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCAAGAAGGATTGCATCGCTCG
TAGCGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTG
CGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCACACAACTGATCCCACGATT
CCGCCGGGATTAGGATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCTGCTTCGAATGGATCCACTTCTGC
ATTCCCTCCCCGGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTC
AATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCAC
TGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGTTCATTGATTAGAGGCATCGGGTACACCATCAATCGAGTCAGGCTGTT
AACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATAATTACCACCGGAGATGCCCACGGGGACGTTGAGAAACTGATGATC
TTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACAT
CGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCAC
TTCAGCAGGTTCATTCGCCCCTAGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCA
AGATCTTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCCGTCTTCGTAGGATC