Description :
From Genome Similarity Track
Location :
Scaffold_334:9412- 13764
Sequence
4352 bases(100 bases per row)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACCAAGATCGCCCGTTCCACGTTGT
GTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACTAATCGCGTCAGCTGAAGCCA
GCTGAGCGCAACTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTACGCCCTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCCTGG
TCTACACAGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATTGCTCTCATTCTTCGCAGAGTGTAACTTCCG
GGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCC
ATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGATGCGAAGCTCTTGCTGGCCTACGGCTCAGCGC
CTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGA
CAACTCGGACCGCGTTGTCGTGGCCACTGACCATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAG
AAGACATACCTTTTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTATGAAGC
CTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGCTCGGTCTTCCCCCCGACAG
CCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTGAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGT
CTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGCTTA
CACTTCTTAAAGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGC
TACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTTGCCATCAACAACTCGGTACATGCCTCGACCGGGCATACACCGTTCTACG
TGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCAGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAA
TGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGATGTCGACAAGAGCAAGAAGAAG
AAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCT
CGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTACAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTAACGCAGACANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGCGTCGGACCAAGGTAACCC
CAAGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATA
GTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGACGTCCTGCTGCAGGACGTTCCG
GAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCG
TTCCTCACGTGCCAAGAACTTGGTACGGGGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCA
CCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCGCCCGCGCGTCG
AGAATGTCTCGAAGCGTTCACGGGCGTGCTTAACCCGCTGGCGGTAAGCAGTCCGCTTCTTGTTGAAGTTCTCAACAAAAGCGTTCCAACTTTGACAAAG
TGCCTGCCATTCAGGCACTCTGCTGAGATAAGAAGTCTTCCTGCTGGAGAAGTATCGGAGCTCGTGGAAGAGCCCGATGTAATAATCGCGCCTTTGATTC
GTTAACGGATCAAAGTGCTGCTACTCCGCAACAGCATCATCGTAAATAGTGT