Description :
From Genome Similarity Track
Location :
contig_5:941120- 942488
Transcript NameFunction/comments
g1492.t1chromatin-remodeling complex ATPase chain, putative

Sequence
1368 bases(100 bases per row)
GTACGATGCGTGCGTACCAACTAGAGGGACTCAGCTGGATGGTCAACCTTGCACACCAAGGTATCAACGGTATTCTGGCCGATGAAATGGGGCTCGGAAA
AACACTCCAGACGATTTCAGTGCTGGGCTACTTTTACGAGTTTGAGAACATTTCTGGCCCGCACATTGTCCTGGTGCCCAAGTCTACACTGAGTAACTGG
CTGGCCGAGTTCCAGCGCTGGTGTCCATCTCTGCGTGCCGTGAAATTCCACGGTAACAAAGAGGAGCGCCTGCGATGTGTTCAGGAGGTGTTGTGCCCCG
GTTTGCCCGACGAGAAGCGCAAGTTTGACGTGTGTGTGACTACTTTCGAAATGTGTCTGAAGGAGAAGCAGCGCAATGCAAGTTTGCGTGGAGATTCCTC
ATTATTGATGAGGCGCATCGCATCAAGAACGAGAGCTCCCAATTCTCTACGGTCGTCCGTATGCTTGACACGGAGCACCGACTGCTGCTAACGGGCACAC
CTCTTCAGAACAACCTGCACGAGCTGTGGGCATTGCTCAACTTCCTGCTGCCCGATGTGTTCGCATCGTCTCAGGAGTTTGACGATTGGTTCAATCTTGA
TGTGGATGATGATGAAGCGAAGAAGCAGATGATTAGCCAACTGCACAAGATTCTGCGACCATTCATGCTTCGTCGTCTTAAGGCGGATGTAGAGAAGAGC
CTTCCGCCGAAGAAGGAAACGCTGCTGTTTGTGGGCATGTCCGAAATGCAAAAGGCACTGTACAAGTCGCTGTTGCTCCGCGATATGAACACAATTATGG
GCGGCTCAGGTGGTGTGTCCAAGAGTGCGCTACAGAACATTGTGATGCAGTTACGAAAGTGCTGCGGCCACCCGTATCTTTTCGAAGGCCAGGAGGACCG
GTCTCTAGATCCTTTGGGAGAGCACGTGGTGGAAAACTGTGGTAAAATGGTGCTGATGGACAAGCTGCTGAAGAAGCTCAAGCAGCGTGGTTCTCGTGTG
CTCATTTTTACGCAGATGACGCGAGTCTTGGATATTATGGAGGATTTCTGCCGCATGCGCCAGTATAACTACTGCCGTATCGATGGTCAGACTTCGTATG
AAGATCGCGAAAGCTCTATCGATGAGTACAACAGACCAAACTCGTCCAAGTTCCTGTTTCTGCTGTCCACCCGCGCTGGTGGCCTAGGTATTAACCTGTA
CACGGCAGACGTTGTGATTCTGTACGATTCGGACTGGAACCCGCAAGCCGACTTGCAAGCTCAAGATCGTGCGCATCGTATCGGTCAGAAGAAGGAGGTG
AATGTGTACCGTTTTGTCACGGCGGATTCGGTTGAGGAAAAAATTATTGAGCGCGCACAGCAAAAGCT