Description :
From Genome Similarity Track
Location :
Scaffold_1820:941- 3112
Sequence
2171 bases(100 bases per row)
CCCCATCAAGCCCTGAGCCACTGCGTGGCGACGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCAC
TGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTA
ACGCGTTCGGTTTGACCATCGGTCTGCGAATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGA
AGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTC
CGGCACTGCCGCTAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATGCCCGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCA
TACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTTTCACACGTGCG
TACATAGGTGCCGACCCCCTTATACATCTTGGGCCACCAGTACATCGAGCATACCGAGCCATAGGTCTTCTGCCGACCTAAGTGTCCGCCCACGGGCGTA
TCATGAACCTCGTTGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGC
CATCGAGTGAGTATCGATGCAGCCTCGCGCATAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACGCTTCGCTCCCAAGAGCCCGTAGCAGCACTAC
GCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCATGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGC
GCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAG
GCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCAT
TGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCT
TGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGC
TCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACTTTCCAGCACCATGGTGCGTCCTTCTTAAGTAGATCTGATAATGGCCGAGCCATCTCCGCGTA
GTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTG
GCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTAC
TAGTGCACATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATATTGTGGTGAA
GTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACG
GGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACC
AAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATG
GTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCC