Description :
From Genome Similarity Track
Location :
Scaffold_86:941- 2168
Transcript NameFunction/comments
Phymu_g3860hypothetical protein BATDEDRAFT_20316
Phymu_g3861hypothetical protein

Sequence
1227 bases(100 bases per row)
GCGGAACTGAACCCGCAGGTCGTCAAGTGGTCAGTCGAACACCCTGACAAAGAGGCGGGGGATGTGGCCTCCAGCGACAAAGTGAACCCTGacggcgacg
tcgacatTTCGTGGGACTACGACGGCTTCATCTACCCTGCGTGCGGCGAGTGTAGCGGCATCATGAAGCCCAGGTACGCGTGGAGTTTGATCTGATACTG
TAAGGCGGGCAGTTCTCACTCGTTTGCTACGTCAGAGTCGTGTTTTTTGGCGAGAATATGCCAGCAGCTACGCGTTCAACCGCACTCGAACGCGTGCGTG
ACGCCAACGCCCTATTGGTTGTGGGCTCATCACTGAAGGTCTTTTCAGCCATGCGTCTCATTAACCACGCGCATGCTCAAAAAATACCGATCGCCATCCT
GAACTTGGGACCGACACGTGGAGATGAACTGAGCAGCTTACGAATCGACAAGTCTTGCACTAGCGTGCTCACTGAGGTGGCGGAGCTGTACCACTGATAG
ACAAATAAGCAGCAAAGCAGTCTAGAGCGGATAAAGACAACACCTGGACGACAAAAGCAGAAGTGTACCAGATCAATTTGTGGAGGATGTAATATCTAGA
TCAACTCCTGTCGTCGAATACCTTACACACGCAAAAACGCAGCAATCTCTTCACATAGGAACCAGCAACAAAAGCTCCGTGAGCTGTCAACGCTTCTTAG
CTCCAGACAGTACGCGTCGGTAGCACGGAAGAGGAACCCCCGACGGGTAGGTGCGGCTTCGCAGGGTTTCCAGAGTTCGCCGAGTTTAGGGATGCCACCC
GCTGCGTCAACCAGCTAGGTCCCTGGGACTTGGTTGgttcttccttctccacctccagagTAGGAACAACTTCAACCTCTGACTTTTCTGGCTCCGAAGC
AGGTGTCGGCTCAGCAGGAGTCTCTGGCTCAACAGTCTTTGGCTCTGGCTTCGGTGAGTCCTTTTCACTGTTAGTTGCGTCagcgtcagctgcagccttT
GCAGCTGTGTCGACGCGGAAAGTGATCGAATTAGAGTGGTCTAAAGGACGGCGTTCCATGACCGACTGGCTGGCATTGGCAAGTACGGgaacagctgcag
ccgcctcGCGAAGCTGAGCATCCGAGAACTGGCGCAGGTTCACAGTCGATTCCTTCACGCCGAGAAGCGGTCCGTTGTACTCGggcatcgtcttctggaT
TGTACGGCCAAGTGCGTGGATGCACTG