Description :
From Genome Similarity Track
Location :
Scaffold_111:94076- 95288
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14064oligosaccharyl transferase STT3 subunit
Sappa_CBS223.65SPRG_14065Hypothetical protein

Sequence
1212 bases(100 bases per row)
CCTTGACCTTGCGCGCCCGCTGGTACCTAGCCATGGCGCGTGAGGCGAGTGGGCGAGAGCGAGCATGCTACCGCGTGTACTGCGCCTGGAAGATGGTCTC
GTGGCTGCAAAAGTTGACGTGGAAGGCGCTCGACGCGACGCCCGGCGCGAGGTCGACCGACATGTCTTCTTTTGTGTTAAAAAAACATGAAAAATGTTGG
CCCCCCACGGGTGCAATCCAAAACCATTTGATTACGAGACCACGCGACAGGATGAGGGCCCTGGCCCTGGTCCCTCAAAAGGTTCCTGTGATAGAGTGAG
GTCCAATAAACGTGTCGTGAAAGAGAGGGCTGGCAACATCAAGGGGGTCGGTCTACTACTAGTACAAGATATCGAACTATCGCAATTGGGTGGCCTCGAC
TGCGCCACGTGGAGCAGAGATATTTCGAATCCAGGCTTGGGTGGAAACGACGACGTCATCGAGGGAAACGTCGACAGCTATCGCTCCGCTAGTAGCCAGA
GCCACAACGTCGATGAGTCCTTGTGAATGTTGCCACCTCCATGCTGTCTTCACTACTAGTAGTCGCGTGCCCTCATCCGCAGCAAGGTGACTAGAGACCC
GTTTGAGATACCGACTTTAATCACGCACCGCTAAGGACGCAACCAGCGCCGCGCAGAACCCGTTGATCCCGGCTCTGTGTCGTGCTCCGAACCACATTTC
GGTAACCGGTTCGTCAAGGACGCCGTGCCACGAGCCTCTTAACAGCCGCCGGCGTATTCGTATGCCTCGTATGTTTGCTCCCGCCGATGCTCCAAAACCC
ACCTGGGCGTAGCCGGCGGTGGTCCTAGCCTCCAGAGTCCTCTCTGGGCGGTTCCAAGCCAGGACGCACGTCTCTCTTGGCTCGCAGCGACGGGTGGACC
TCTGCCTCTGAACTCGCCACCGAGCCACTAATAACGTAACCAACGAGGTGACATTGGTTTCGGTAGGTTTCTGAGGAGGCGATTTGGTCCCGATAGAAAG
CAAGACGATCGCCATGACATCATTCCCCGCGTGTATAGCAACACGCGTGGACGAGGGATGCTCGAGCGCCACGGTGGAGCTCGTGCTCGTAGCTACGTGC
GTGCTTTGAACGAGTTGACCACTTCGTCCTCGCGGCTACAGCTCAACGACACCTGGGGCCGCCCTTGCATCGTGGTAGATGAGCTCGCCGTGCATGACGT
CTTCGATTTGCG