Description :
From Genome Similarity Track
Location :
Scaffold_36:94022- 95607
Sequence
1585 bases(100 bases per row)
CCTTCGATATCGAGCGTAGATCCGGACACACCGCTCAGACTACCAACGTATGGTTGGAGAGAGGAGTTAGTCAAGCCGAGACGCTTCAATACACGCCGGT
GCACTAGGCACGCTACGGCCCCGGAGTCGATGAGAAGTTCCACCGGGAGGTTCTCGATAAATCCCCACGATAGAGCTTCCACGCCCCCCCCACTGATCCG
ATCACCCGCTTGCCGAGGGGGACGACCCCTTCTTCCTCTTCAGCTGACCAGTTCCTTCTAGTGCTCGGTACTTCCACCAGGCCCGGCTTGGGGCGGGGTC
CGGAGTGTCGGCGACGACGTTCACATAGCCGTATAACCCGTTTTCTTTATCGGGGGAAGAACAGTTCGTACCGAGGGCTTCGGTACGGTCGTTGAACAGA
GAGGAACAGTCGAAACTGACTTGCTTCGGTTTTGGGGAGTACGTAGGACCAAGATTCTTCCGACGACAGAGTCGGCAGGGTGAACTCCTGTCGAGGATCT
TCAAGCGTAGTTGATCAGCATCCTTCTCGTAGAGGTCCGAAATCCGTTTAGTTAGCAACTCCCTCAACCGCGAGTCAGCGGGAGCAGCGTGGCGCTCGAG
TAAGTCCTCGGTCCTGGTTAGAAGGTCTTGGAGCTCAGTAGGGGGTGGGGAGCTATCTTTCTTCTCTTCTTCTTGCGATCCTTCGTCAATACACCCTTCA
CACCAGCCACCTCCACTAGAAGCTTCAGCCTTTATGAGGAAGTATACTACTCGCCGCACCACGGCACGCCAAGGGTCAGGCACGATACCTCGAGAGTCCC
ACAAACCGTACTCGGTTTCGCTGAGGTCAGAGGGTCTCTCTGGAGAACTTCCCAGGGCCAGCGCGATATTATCTTCCACTACGGAGGGGTCCACGGGACA
CACTTCTCCCGGTAGAGGTGGTATCTTCAGCTCCGGAAAGTGCACTATCGACTTAGGCACATCCTGCCACGAAAACCTCTTCGTCGAGGTCCCGCCTCCT
TCGTCTCGGTAATCGGAGTCGTCCGAAGTCACAGAGTTGATCCGTACCGGCGATTCCTCTTGGGAGTTACGGCTGGCGCGATTCGCTTCTCCGGATGAGG
CCAGCGGCTTTTGGAACCATTCCAACCAGTACTCCGGAGTAGATAGGTGACCGAGGGAAGAATCTCGGGACCTCGCTAGTTTCTCTTCGGGAATGTCAAG
CAGGACACTCAATTCGGCAAGAGATAACTCCTTCAACTGTTCCACATTCTCGACCAACCGGCGCTTTAGTTCTGCCTCATCAAGAGGGAACAGTCGGTCT
TCGAGTTCTTTGTCGTACTCTTCCTTCTCTTCGGCCAGCCCAGAGGGCTCTCCGTCTTCTAAAGCATTCAGTTCTTCCTTGGTGAACACCCTCGTGAAGG
AAGACCCCTTCTCGGGTTCACCCTTAGCCGAACTGACACTGACAACGTCCTCAGAGTCCTCTCTGGAGGAGTCGTTCCTTCCGGGAGGGGTCCCTCTCGC
GTAGTTCTACCTTCGAGACGGGGACACTATCTTCTGTAGTTCCACACTCTTCTTGGGGCGGGCTTTCGAGTACCTCCGTCACGTC