Description :
From Genome Similarity Track
Location :
Scaffold_417:940- 6798
Transcript NameFunction/comments
Phyta_totarag8110hypothetical protein

Sequence
5858 bases(100 bases per row)
TATTATTTATTTCAGCCTTTATCATGACATTCGTTACTTTACTTTACTAATCACACGCACTACACCAAACAATAATGGAAGCAAGCCTCCTCTAAACTCT
ATACTCTAAATTCTAAACTAAACTCAGCTCACATTGAGCTTCGCGGTGAGCTGTAGATTACCGCCTTGTGTGGATCGAGGCacccacagcaacaacgaac
CGCCACCTGTGCCTGGAAGACCCAGGAATCCCGGACGCCACCGATCCAGATAAAGCGTCTTGCCTCCCAGAGCTGTCACGTTCGATCTCCACGTGACGGT
CGTACCCGACGCGACAGCCACTTCATCGAACTTGTTACCACCAGACTTGATATTCACGGTTACGTCCTTCGTGTCAACACTCCTGAACGTAATGGTGACA
GAACCGTCACCAATCTTGGTCCAGTTGCCAGCGCTGTTGTTGAAAGCCGCCTCCACAGTCTTCAATCCCAGCGCTTCTTTAGCAGAGCCATCGTCAACTT
CACCAACAAACTCTGTGGGGCCGCAAATGGTCTGGAAGAACTCGGACATCACACCACCGATATTTTTTCTGTCCCAAACAGCGTAAAACGTTGCTATCTT
GTCAGCGATCTTGTATGCGTATTGTCCGGCTGTCAGGTAGGTGCCGTTGTTGCTCGTTCCTGAGCTGATCAAGTCGTCCATAATACCCCCGATACCCTTG
CGTAGCGTATCTCGAGTGGTATAAGCCGTAGATTCGTCAGACTCGGCAATCAGTTCGTCCATACAGTTGTTTGTCACGGTAGGAATTTCATATAACGCGA
GGTTCGACTTGCTCATCGCAACACGGATGTCATCCTCCGAGATACCCGGGTTCTGTCGACGCAGTTCTGCCACCGTCATCCACGTTCGGTCCAGAAGTCG
CTTCATGTCGTAACCACAGGTCGAGTTAGATTCCAGCGCCGTCTTTAAAGACGTAATGTCCGTCTCGTTCAAAGAGCTGATCGTCTCACCGAGGGTGATG
TTCTTCATAAAACTCGTGAATGCAGTCCAACTGGAAAGAATAGCGGCGCCGTTGGCTATTACTTCTTTTAGGGTCAACTCAGCAGTATTCAGTAGTCTGT
CCGCGAACTTGAATTGGTCATCCACTTTGATTTCGAGGCACGAAGCAATGGTCACTGGAATATCGAAGACCACATTATCTGTTTGGTACAACATTGTCAG
TAGCTGGTCTCGAGGCGTCTGCGGGTCACACACTTGGACGGTACGAACGTACTTGGACAACGCCCTGACCAATCCCATCATCTCCTTGCTACACTTAAAC
GCAATTTGGATGCCCTTTGCCATCAGCTTGAACTGGCCGTACATGTTGTAGGTAGCTACGGAAAAAGCTGCTTGGGCCACGGAAGCAATCTTGGTTATGA
TTCCAAGTGCACAGTCGTCATTTTGGCGGATGCACTCCATTCCGCACTCGACGGGGTATGCAAAGGGACACTGTGCCCAGCATGTTCCAAGCTTGCCATC
GAATCCCTGGGGGCACGTCTTCGCGATATGAGCTTCACGATAGCAGGCCGTGTCGGGTACAGTGCCCAGAGCAGAACCTATCCAGTTCTTGTAGGTGGAC
TTGATCGTGCTGGTTGCATTGAGCGCGTTACCAAATGTAAACCCCGAAGAACTGCCATCCACCTCTAACGAGGAgtcactgtcgtcgtcgctgtcgtcgt
cgctgtcgtcgtcgctgtcgtcgtcgctgtcgtcatcgctgtctgAAGAATCGTCATCAGTGCTTCCTATAGATCTCTTGTTGCCTTCACTGTCTAcaga
ctcgtcgtcgctgtcttcatCGACGCCGGATGACTTGGAGGAGGACACCGTGAAATTTGAAGTAATTGCAGTGCCATTAACCGTAAAATTGGCGGCTGTC
ACAGTTGCAGTTGGTACTGATGCTGCGCTTTGGTTGAATGTGTAGGACTGTGCCGAGGCGGCAGCATAGAGTATCGCGAATACGTGGGTTAGTACCAGCG
GCAACCTGGTCATTCTACTTGAGACGCGTGCGGCGAGGAGGCCAATAGAGGCGACGATAGCCTCGAGCACCGCAAAACGAAGAATGCCTTACCGTTTAAC
CAACCCGCCAAACGCCTCTTTTACGAGCACCCACAGCTAGACAACTCGCTGTATGAGCCCTGGCATGTGGTGACCGTCTCAATTCCTATAGATTCGCTCG
TGAACATTGTTGTCAAGACATAAACGCAGTCTTTAGGATTGCATCGAATCTACCGTTCCGGCGCAACGGCGAATCTAAGTTCATGTTCGTAGGCAAAGCC
GCGGAGGCAGATCACCACGGACCAGCGTGGGGGTGTTGACGGGCCTCTCTCTCACTTCAGTCTTTGGATCGGGGCCACCAAAGTTTGGTGGCTCGTTTTG
GACAAAGGCTATCGCGTTGATTAACATACATTCGGAGTACAGTATCATTTACACGACCAGATGGCCAAATTCAGCAACTGTGAGTGGGTCTGTCTCCGGG
ATTCAATTGGCTGGGGCTAATGCTTGCCGAGAATCTGCCGTCCTCCAAATCCCGTGGCGTGGTGATATCATTGGGATGTCAAAGAGGATTGGTTGGCCCA
TAAATGAGTCAAAGGTAATACTAGTagcgatgttgaagtgatttgCATCGATTGTAGATTCGAGGTCGAAGATATTGATACAAtttacagtacatgtacc
aaggTATGTAGGCTGCATACCGCTGCAGTCTCCTGAGGCGGGTAAAAGCCTCAACAGACCGTCTCAAACTCATCAATCGTTTCAACGATTTAGCGCTGGA
CTGGATAAACAGCGAATCTACGTGCGCATCTGCAATTTCACCAGCGGTCAGGCCCCTGAACTGCTGGCCCCGCAGCGATTTCTGGACCTCCGCCTTATCT
CCTGCACTGTTAAGACTGCATGATGTGATCCAATCGTCTTGTTCTCGTTGCTCTCTACTGTACAAatacaatacatgtattgcttTATAAGCGATGGGAC
GCGGTACATATCTCGCTCTCTACTCAACGCTGTGCTCGGCCTGACACTGGCGCACGCCATCGCTGCACAGCTGCGACGGTAACAACTTCCATGTTGCCAT
GACTTGCTTGCTCGAACAAACTCCCACGCGAAGGTATGCGGCTGAGAGTAGGTCATTCAAACGCTTGTTTAGACGCGGCAGCCTTGCTCCTCAGAGTGCG
CAAAAACTCCCGTCGCGACTTCTCGTCGTTGTAATGTGTTGatctctcttcttcttgctgatcTCCATATTGGGTCTCCACTCTAGCTGAAGATACTCCA
CCGTCCATCACACTGTTATCGCTACCGCCACCGTTAAATCCATCCGATTGCTCGTATGAAAGCGCATCCAATTCATGAGCCAGCAGAAACTCACGGATCT
CAGCGATCTGCCGTCGTTCCCGAGAAAACCTTGTGTGTTGTGCTCGATCGGGCCTGCTCATACTCTCGAATGCACGCTGAAATCTCCTTGACGAATGCGG
CAATGGTAATGGCAACTCTACTCCTGCGTCACCTGCaccggcagcaacaaccgGATCCGCTACCGTGATCACCGGTACCAGAGCCGTCTTGTGTGGAAAG
TAGTTGCAATGCTCGGGAACGTCAACCTGTACTTTTGCGACTAACACATGACACCCGGGACGGTGCAAATCCAGCTCTCGCGCTAGATACCCGGAGATCC
TTGCCCCAGTCACACAGTGTTTCAGCACGGTATCCAGAAACTCATGCCACCGTGAGCtaccaacaacaagaaaGTAAACCCCTCAGTACGCCGAACTTTC
CGTTATCTCCTAATTTTTAGTCTATCAACGCACCGTTGTCGAccaactcctccaccatctGCAGGTAAATCCCCCGTTTCCAGTTCCGGAAGCGGAtagt
cgtcgaagaagacacAGTCGAATTGGTCCAACGTgggcaattgctgctgccatgtGCCAGACACAATTTCCACTCCTTTGTGACTTGCTGCAAACTGCTG
AGCACGTTGCAGCGCCTCCTGATCGCATTCGATGATAGTGTGGCTTTCGGGCCGGAATGACTGGATGTGAGACGCCGAATAGGCCAACCCGAAGCCGATT
TCCAGCACGCGGTCCGTCGGTTGGATGGCAAGTGCATCTACACACAGCTCCATGTATTGCTTTTCCCACTGCATCATCACCTGCTGTCCGCGGGAGCTCC
AGAGCACCTCCTGTCCGAGCTCATCCAGCCCCTTGATGTTGCCCTGCGTCGTCATTGCAAACAAAATTGTgcagatacatgtatacaaaTCACAAACAGT
TATTTTGTGAATTGTGATTTATGTATTTGTTTAGTCCAACACAATTATTTTTTTaggacaacttcaactgaCGGTGAGCATCGCATTGAGCTGCAGGTTG
CCACTTTGAGTAGATCGAGGGACCCACAGTAACAAGGAACCACCTCCAGTCCCGGGAAGTCCCAGTAATCCCGGACGCCATCGGTCCAAATACAGCGTCT
TTCCTTCCAGTGTCGTGACATTCGAGGTCCAGATCACAGTCCCCCCAGTGCCCACGTCCACCTCATCGATCTTGTCGCCCCCGGAGTGGATGTTCACGGT
AACGTCTGTAGTATCAACACTCTTGAATGTGATGGTAACAGTGCGATCGCCGACCTTGGTCCATGTGCCGTCACTGTTCGTGAAGGCGCCCTGGACGATC
GACATTCCCAACGCCTTTTTCGCAGTCCCGTCGTCGACCTCCCCGATGAGTTCTGTCGGACCGCAAATGGGCTGAAAGTACTCGGAAACTGTACTAGCTA
CACCCCACACATCCCAGACAGCGTAAAACGTTAACGCCTTATCCGCGATCTTGAATACGTACTCTTCAGCTGAGAGAAATGTGCAATGGCACATTTCTCT
CAGCTGCTAGTTCCGGAACTGATAAGGTCATCCAAAATTCCGCTACAGGTCTTCCGCAGTGTGTCACGTGTGGCGTATGCTGTGGTCTCATCCGATTCTG
CGATCAACTCACCCATGCAATTATTTGTCGCCATAGGGATATCGTTGTGTACGAGATTTGACTGGCTCATGGTCGCTCGAATGTCGTCCTCAGACATTTC
CGGATTCTGTTTACGAAATTCTGCCAGTCATCCACGTGCGATCCAGCAAACGTTTCATGTCGTAGCCGCAGGTGGAGTTGGACTCCATCGCAGACTTCAG
AGATGAAATGTCAGTCTCGTTCAACGAGCTAAGCGAGTCGCCAAGTGTGACATTCTTCATGAACGCTGTGAACGAGTCCCAGCTGGAAACAATTGCGTCA
CCATTAGCCAAAACTTCCTTCAAAGTGAGTTCAGCTGTGGTAAGGAATCTGTCGGCAAACTTTACGCTATCGTCAACCTTGATGCCGAGGCACGAAACAA
CTGTCACGGATATGTCGATAACCACATTGTCGGACTGATACAGGATCGTCAATAACTTGGCTTGTGAAGTCTGCGGATCGGACACTTTAATTGATCGAac
gtacttggccagcgacTTGATCAAACCCAGCATATCCTTGCTACACTTAATAGCGACTTAAAGACCCTTCGCCATCAACTTAAATTCGCCATGAACACCG
AGCGTCGCGAAGGATAACGCCGACTGGGCAACGACCTAAACCTTGCTCACAATTTCAAGTGCACAGTCGTCGACGGGATACGAATATGGGCACTGCGCCC
AACACATACCAAGGTTACTGTTAAATCCCAGTGAACACATCTTCGCGACGTGAGCTTCCCAGTAGCACGCCCTGGTGGATGCAGTGTCGAGTGCCGAACC
TACCCAGTTGACATAAGTAGACTCAATTGTGCTAGTAGCGTTAATGGCACTGCTAATC