Description :
From Genome Similarity Track
Location :
Scaffold_190:940- 3248
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_190-fgenesh-gene-0.3Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_190-fgenesh-gene-0.4Delta(5) fatty acid desaturase

Sequence
2308 bases(100 bases per row)
CGTCGCGAACGTGAACCGCAGGCGCTGCACGGCGCGCAGGTTGTGCTCGCGGCGGCGCGCGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCGCGCGCTGAGCTCGTCCATGACGCTCGTGTGCGGCCGGTCGGCGGCGCCGTGCGCGAGCAGGCCGCGCAGTGGC
GCGCTCTCGAGCAGCGCCATGAACTGGCGGCGCGAGACGCGTGTTGACAATGAAAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTGGGCAGCGTCGCGAGCGCCGCGCGGATCTGTTCGTCACGTTGAAGTGCGTGGCACACACGTTGAAGTTGAAGTTGAAGCAAGTGCGTCAGCACTTCG
TAGCACGTCGCAGATATTCAAGACAACAAATGACGCACGCGGTCGGCGACGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCGGCGCCGCGGCCGAGGTCGAGGTAGCCGTCGCGGGACGCGAAGACGGTGAACGCCCACTGCAGCTGCTCGCGCATGGGCA
GCAGCGGCTCGCGGAACATGCNNNNNNNNNNNNNNNNNNTTAATACTCATCAACGACAATGTCCAAGCAGACACGATACGGACCGGAGGGCGACGAGCAG
CGAGCGCCAGTGGAGCGCCTCGACGTCGTCGTGTCCGCGCTCGCAGCAGCTCTTGAGCGCGTCGAGGTGGCGCGCGAGCGCGGCCTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTGGCGGATGCCGAGCGCGGCGCGCAGCACGCTCGTGAAGC
GCGGCTTGGGCACGAGGTCGTGCGGGAACGAGCGCGCGAACGTCTCGAAGAGCGCGCGGTCACCGCCCGCGAGCCGCACGCCGTGGAATGCCGGCGCCTG
CAGCAGCGCGTGCTGGTGCAAGGCAGCAACGCGATACGAGTCAGTCAGTTCTTGTTGAGGGGATCAAGCTGCAGTAAGTGGAGGCATATGAACCGACCAG
GCGGAAGAGCTCGCGCCACTTGTTGGCGTGGAACCGCTCGAGCGTGACGCTCGCGGCCGACGCCGCCGTCAGCGCCTTCAGCGCCGCAGGACTCACGACC
CACTCGCCTGCATCAGCGTCCGTGTAGCTTCTGTGTTTGGTTCGAGCAACGGATCGCTGCTTCTTGTTATTAGAGGCAACATCTTGAGCTATTGGCTCGA
CGGCGGCAGGCTCGTCAGGATCAGAGTCGTCGCTCCCGTCGCTCTCGTCAAGCAGCGAGCTGCTGATGACCGAGTCGGCGTCCGCGTCTTCCTCGTCGAG
GCAGTCGAAGGCGCTGATTGTGCTCATGACAACCGAACGAGAATATGCAGGTCGACCTTTCAGACCGCCGCGAGTGCAGCACAAGCCAGACGACAATACC
AACATGCATAAGCAGTGAAGCAGTGACCCGTTCATTCCACTCGCTTACATGGAGGCGCCTCGAGCGCTCAGCAGTAACACGCAAAAGAGAGAGAGAGAGA
AATGCAGCTTGGCAATCTGTCCGTCCGCCTTGGGTTCGAAGTCCAGAGAGCAGAGTTTAGACTGCGACCATGCCAGCTCAGCCCATGTGCACGGACACGG
GCTTGCCGAGCTTGCCCATGATCTTGAGGTGGTCGAAGTGCTTGAGCAGCGCGACCCAGAAGCTCGGCAGCACCGTGTACTGCACGTCGTGCTTCTTGCA
CACCTCCATGATGATCGGCGCGATCGCCGGGTAGTGGTACTGCGAGATGCCCGGGAACAAGTGGTGCGTCACCTGGTAGTTGAGCGCGCCGGCGAGGAAC
GTCGTCACGAACGACCCGTGCGCGTAGTCGACGGACGACTTGACCTGCGACACGGCCCACTCGTCCGCGATCTCCGGAGTCATCTCGTCGCCGCACGGGT
AGTCGCACTCGGTCGAGACGTGGCTCACCTGGAAGTTGAAGGCGAGGTACCAGCCCGTGACGAACTCGGCGAGCAGGAAGACACCCCAGAAGCGCGACGG
CGCCACCTGGAACACGACAAGCGGGAGGTAGATGCGGAAGAAGATCCAGAAGCTCTTGGAGGCCACGAGCTCGATCCACTCGCTGAACGGGTGCGGGTTG
ACGCGCAGCGGGCCGTTCGTGCGCGCCAGGAACGTCTCGAAGATGTCCTGCACGCGGAACTTGAGGCCGAGCACGCCGTAGAGCGGCGGCAGGTACAGGT
GCTGGAAC