Description :
From Genome Similarity Track
Location :
Scaffold_1662:94- 3585
Sequence
3491 bases(100 bases per row)
CGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGCTCAGCTCGTTTCCAGCAGTAGGCCCGGCCTC
TGCGTTCGTCTTCGCGGTGTCGGTGCCCTGCACAGAACCATTCTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCTTCTTC
TTCTTCTTGCGCGTGGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAG
CCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAA
CTCCGCCATCGGCAGACACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCAACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGACC
GTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAGAGATGCGCAGTGAAGCGCGGGTCTCGATCCGACA
CAATGTCGATCGGCATGTCATGGTGTTTGAACACCATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTAC
CATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATATACTGCCAACAC
TCCGACGGAGTCGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCGTCACACGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATT
TATACTGGTGGGCCCAGTAGAAGTCTCGCGCGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGAT
CCTGAGTCGCAGGTCGTGGTCATTGGGAACGACAACACGGTCCGCGTTGTCATCGACTGCACTGTAAAGTAATAACCCGTCGTGCACCCGATAACGGTGT
GCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCATAGGTCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACG
CGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCACGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACG
CGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAG
ATGTGCGGCGACTTCACAGCTGTCCGCAGCGACGTGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGT
ACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTG
ATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACTACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCACCTCA
GTCAAGCCCCTCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGC
CCACGTAGTCTTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCT
GACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATGTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAG
AGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACAT
CGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTTTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCAC
CAGCCACTCCCAGAGCATGCCGCTCGTCGTGCTCACTGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAGCCCATCGCGCAGATCAAGA
GCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTATG
CATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCTAGCTTTGCGACGACT
CTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATATCGTGCTGG
ATGCCCTTGTCCTGCGGAAGCTCCGCAGGGGTCTCTTCCGGAAGCACGTCCGCGTGCTCCCGTAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCC
AGCTCTTCTCCTCAAAGCGCTCCTTCTTAGTCGTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTC
GCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTACTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCACGACTGGAAGCGAA
GTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCATCAAGACGTTCAACGTCTCGACGTCCG
GCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGGGCCGTCTTCTTGTCCT
GCGGAGCCCGGCTCCGCATGACTCTTGAACTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCG
ACTTCCAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGAGACGTTTGCAACCGTCCGCAC
CGCCTCCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCC
GACGAATCAAATTCACCCATGCCATCGACTCCCGGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAACACTGATCCAATCA